This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U568367, SGN-U568368, SGN-U568369, and SGN-U568373 in the current build, Tomato 200607 #2
Unigene SGN-U213290

Unigene Basic Information 
Unigene ID: SGN-U213290
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213290
mRNA sequence: Length: 1875 bp

>SGN-U213290 Lycopersicon Combined #3 (75 members)
AGGCCGACCTGGGGCCTGATTTGATGAAGTGAATGCGACCAAAAAAGCAGCTCTTTGGTCCCCTCTCCTTCTCTTCTCTTCCACATTCCT
TGTGAAGAGTTGCGCCTACAAATATGGCAAACCCTCCTAAGATTTCTTCCACCTTCTTCTTCCTCTCATCATCCTCTTCCTCTTCCTCTT
CCTCTTCCACCTTCAAACTTGCTGACTTTTCTAACTTTATTCTTTGACATTTATAATACAGATCTCTATCTTCTTCATTCAATACATACA
CAATACAATACCAAATACAAGATTAATAATATTCTTTCTGCCTAACCTTAAATCTTTGTTTATCAGGTTGAATCTTTTATACAAGGAATA
CTTACTTACATCTATGGGAGAAGCACCAGCTTTCTTTGCTGATAGTCTCTTGGGAGATTTTCCAAATGGGATCGATTTGAAATCTAAAGG
CCACAAAACAGCTATTTCTATCGGCTCTAAAATTTATGTGATTGGCGGGGCTGATCATGAGTCGACAGCGGTAATTGGAGTTCAAATATT
TGAGAAATCTAGTGGGGAATGGATAAACCCCACTGTGCTGGGTACTAAACCCAAGGTCTCAAATGGCCACTCAGCTGTGCTTTTAAATGG
TGATCGTATATTGGTTATTAAGGGCAATTCCAAGTCTGATGAATGCTTTTGGTTTCTTGAGGTGGGCACCTCATTTATAAGAGAACAGGA
AAAGACATATGGAACTGAGGTGGTTGCCTGGAGTAAGGGAGTTTTAGGTAATGTGGAGAAGCCTATTGTCATTAGTGGCCCTTCTGGAGT
GGGGAAGGGTACCTTGATATCTGAACTAATGAAAGAGTTCCCATCTATGTTTGGATTTTCTGTGAGCCACACGACCCGGGCCCCAAGAGA
AAAAGAGCAGAATGGATTTCATTACCATTTCAGTGACCGCAGTGTAATGGAGAGAGAGATAAAGGATGGGAAATTCCTGGAGTTTGCTTC
TGTTCATGGTAATCTTTATGGAACCAGTGTCGAAGCAGTTGAGGTGGTTGCTGATGCTGGCAAGCGATGCATCCTTGATATTGATGTTCA
AGGTGCAAGGTCTGTGAGAGCTAGCTCTCTTGAAGCTATTTTCATTTTTATATCTCCACCATCATTTGAAGAACTTGAGAAGCGCCTTCG
TGCAAGAGCAACTGAGACTGAAGAGCAAATCCAAAAGCGTCTCCGAAATGCTAGGGCGGAACTCGAACAAGGAAACTCATCCGGTCTCTT
TGATCATATTTTGGTGAACGATGACCTAGAAAGTTGTTATGAGAATCTTAAGAACATCTTGGGTCTCACTGAAGGTGTGAAGACTGCTCA
TAAAACATATTCAGAATTAGTCGACTTGCCTGTTGAACATTTAGTCTCGAAGATTGATCAGAAGATTTTAATTAACTGTGGTGCTGGAGA
ATATGAAAAGGCATCCGATAGCATGTATGTTCTGGACTTGTCTTTGGTTAAAGGAGGGGCCCCAGGACGGACACGAGGACTAAATCTATT
TGTGACCAATCCTTCGACTGATAGAGTAAATGACGAAAATCAGCTGAGCTAACCTACCACCTTCTGGTTTCAATAATTGTTTTTCACTTC
TTACATCTCTATACGGGTAGAGAACCACAATTTGACTACGTCATATCTTACATGGATAGTTTAGTCCCTGATGCAGCTATTAAATGAGAA
ATGATTTCTAATTATTAAAAAATTGTAGGTTAGCAGCCTGAACTATTGAAAGCCTAAGATATGTAACTCTTCTACTCGAGGATTGAGCAT
GTTGGATGTAATTCTTTCAGCTTTTTCTATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCAGACTAGT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (18)  
mRNA member sequences (75)  
Alignment image suppressed for unigene with 75 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 1 | blast: 2 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)