This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U579869, SGN-U580965, and SGN-U591049 in the current build, Tomato 200607 #2
Unigene SGN-U213371

Unigene Basic Information 
Unigene ID: SGN-U213371
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213371
mRNA sequence: Length: 1434 bp

>SGN-U213371 Lycopersicon Combined #3 (76 members)
GATGCTGACACTTGGGTAATTTTACAAATTCTACAACATTTATCTCTATAAATTATCAACCTCTTTCCAAGCATTTTCATCAATTATGGA
AGCTACAGCTCCACTTGTGGTTAAACCATCCAATGTCAAAGAGCTTGCTGAATCTCCTGATTTGCGTTGCATACCTTACAATTATGTTTA
TGACTCTTCCAATTCCTCTGCTACAAATGATATTGATGATTCAGATTCAATCCCCATTGTTGATTTTTCTCTACTCACCTCTCATGATTC
TCATCAACGTTCTACAGCCATCCACCACCTCACCAAAGCTTGTCAAGGTTGGGGCTTCTTCATGGTAGTGAACCACGGCATACCAGAAAA
TCTGATGAAGTCAGTGATTGATTGCACTCATGAATTTTTCAATTTACCAGAGGAAGAAAAACACAAGTTTACTGGGAAGCATGTGTTGGA
TCCTATAAGATATGGGACAAGTTTCAATACTAGTACAGAAAATGTCTTCTTTTGGAGAGATTTTCTCAAGGTCTTTGTCCATCCTCATTT
TCACTCTCCCACCAAACCACAAACCTACAGGGGTATTATGTCGGAGTATAGTGAGAAACTCCGGGAAGTGACAAGAAAGTTACTAGGAGG
CATATCTGAAAGTTTAGGGCTTGAAGAAAGTTACTTGGAGAAAGATTTAGAGTTGGAATCAGGGCTTCAAATCTTCGTTGGAAATTACTA
TCCACCTTGTCCTCAACCTGAACTAGCAATGGGTATGCCACCTCATTCAGATCAAGGCCTTTTAACACTTCTCATTCATAACCAAGTTGG
AGGTCTCCAGGTTCAACATCAAGGCAAATGGATTAACGTCAAGGCCCTTCCTAACTACTCTCTCTTGGTTAATACCGGCGATCATCTCGA
GATATTTAGTAATGGGAAGTACAAGAGCAACATGCATAGAGCAGTGGTGAACAACAAAGTAACAAGGATATCAGTAGTGGTAGCTCATGG
TCCATCATTAGACACAATTGTAAAGCCAGCTTCTCCATTGATGGAAAAAGAGAACAGCCCATCAGCTAATTATATTCCAATGAAGTACAA
GGATTACTTGGAGATGCAACAAAGCAGCCGAATTTATGGAAAGTCCTGCTTGGAAAAAGTTAAAATCCAAAGGAGCTGAGTGTTTCTATG
TATATTTTCCTCTTGTTTCCAAGTGTTTGATGATATAAAAGTATTATGGAACTTCAATAATATTTATGAATACTATAGTTGTACGTGTAA
TCTTTTAATTAGTGAACGTTTTAGCCGTGTCTGTTTATATGTATATCTTCAAATTAAATGTCATTTTCGGATAAGAGGGTGATGCTAGTG
AAGTAGGGTCATTCCATATATATGTCCAATTGATGACTCTTCCTACTCAAATTGAAGATTCAATTGCTTCTCCAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (13)  
mRNA member sequences (76)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (6)  
Annotations (manual: 2 | blast: 2 | go: 3 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (2)