This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U575934 and SGN-U586663 in the current build, Tomato 200607 #2
Unigene SGN-U213709

Unigene Basic Information 
Unigene ID: SGN-U213709
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213709
mRNA sequence: Length: 2553 bp

>SGN-U213709 Lycopersicon Combined #3 (56 members)
TTTGAGGCAGCTGAGTTCCGCAGACTAAAACCCTAGCTCCTCCCTCTCCTTCAACCGTCGTCACGCCGCTCTCTTTTCGTAAACACATAA
CTTTTAACCCCCTTTTTTAGATCATCCTCCATAATCAGTAACACAATTAGATTATCGGAAAAGGCTTGGAGAGTGTAGAAGGCTGCTTTT
ATTGGCTCTTGCCCCAAGTGTAGCTGTTGGTGGATGCGTTCTTATTCATCTTCTATAGTTGAGGGCTAAGTTTTCTCTATGGCTTCCAGG
AGTAGCATCCGTCTTATTTCATACTCGAATGAGATTATAAATGGTGAACCAATCTATATTTCCTCTAACTGCTATCCTATTAAAGCTCAC
AAATATGAGCCTGCTGGGCTTGCTTTTCACTCTGCTGCTCTTAGACTAATTGGGCATGTTGAGAAAGAAGACCCCAAAGATGGCAAAGAA
GATGTTCCTAATGACAAGGAACAGACATTTGCCTATTCATCAGAGTCATACAGCTCTAAGGGGAAGAAGAAGTCTTCTACCGGCGAAAAG
GTACAAGATCATTATGCATTATTAGGGTTGAGCAATCTAAGGTATCTTGCTTCTGAGGATCAGATAAGGAAGAGCTATCGTGATGCTGCA
TTGAGGCATCATCCTGACAAGCTGGCTTCACTTCTTCTAGCTGAGGAAACTGAAGCTGCAAAACAAGCCAAGAAGGAGGAAATAGAAAAC
CACTTCAAAGCTATTCAGGAAGCATATGAGGTTCTTATGGACCCTGTTAGGAGAAGGATTTATGACTCCACGGATGAATTTGATGATGAA
ATCCCAACTGAATGTGCTCCACAAGATTTTTTTAAGGTCTTTGGACCTGCATTTTTAAGGAATGGTCGTTGGTCCGTCACCCAACCCATC
CCTTCATTAGGTGATGAGAATACTCCAATTAAAGAAGTGGATAGCTTTTATAATTTCTGGTACAGCTTCAAAAGTTGGAGAGAGTTCCCA
CATGCTGATGAGTTTGATCTTGAACAAGCTGAATCTCGTGATCACAAGAGGTGGATGGAAAGGCAGAATGCAAAACTTTCAGAGAAAGCC
AGAAAGGAAGAAACCGCCAGGGTGCGTACACTTGTTGACAATGCCTATAGAAAAGACCCTAGAATCTTAGGAAGAAAAGAGGCGGAGAAA
GCAGAGAAGCAGAGAAAGAAGGACGCTAAACTACTTGCAAAGAAATTACAGGAGGCAGAAGCAATTAGGATTGTTGAAGAGGACAAGCGT
AAGAAAGAGGAAGAGGAGAAAAGAGCAGCTGAAGTTGCTTTGCAGCAGAAGAAGTTGAAGGAGAAAGAAAAGAAATTGTTGCGAAAAGAG
CGTAGTCGTTTAAGAACCCTTGCTGCTCCTGTTCTGTCTCAGCGTTTGCTTGGGCTAAATGATGACGATGTAGAAGGTCTATGCATGTCA
CTTGACATTGAGCAACTGAGGAACTTATGTGATAAAGCCGATGGACAGGGTGAGATTGTTATTGCTGAACTTCTTAGGGGGGCACTTGGA
CATGAACACAACCTGAAATATGAGAATAAAGATGAAAAGATTAAGTCGCAGCAAAATGGTTCTCTGGACAGTAAAAAACAAGTTCCTCTG
ATGAGCAGTGAGAAAAAAGAGAAACCTTGGAGCAAAGAAGAAATTGATCTTTTGAGGAAGGGGATGCTGAAATATCCTAAAGGAACTTCT
CGAAGATGGGAAGTTATTTCTGATTATATTGGTACCGCAAGGACAGTTGAAGAGATCCTGAAGGCTACAAAAACAGTTCTGCTCCAGAAG
CCCGACTCTGCTAAAGCCTTTGACTCCTTCCTTGAGAAAAGAAAGCCTGCACCAACTATTGTTTCTCCTCTTTCCACGAGGGCAGAAGTA
GAGGGAGTAGAAAATAGTAGCAAGCCTGAAAGTGGAAGCGCCAAAGTAGCTGATTCTCAGGAGACCCCTAGTCAAAACACAAACAGCCAG
AACACTGAGGATGCACCTACAGCAAACGGAGTTTCTTCGAGTTCTGATTCAGACGTATGGTCTGCTGTTCAAGAAAAAGCCTTAGTTCAA
GCTCTGAAAACCTTCCCCAAGGAAACCAGCCAGCGGTGGGAACGAGTGGCAACTGCTGTCCCTGGGAAGACTATGAACCAGTGTAAAAAA
AAGTTTGCATTACTCAAAGAGAATTTCAGGAGCAAGAAAAGTGCAGTGTGAGGTTAGTGGTGCTTGAAACTGCTGAGTCTAGTTTTTTTC
TTTTATTTCTATTTTCTATTGTTCAGGCAGCCGCAACAAGCTCACTCTTGTAATGCATTGTGACAACACCCCACACCCCAGTCCATTTTC
AGTACCATTTTTGTCATTAAGCAGTAGCATTTACATATCTACTATTCAGTACGGCATTGTGAAGTTACTATACTTGAATACAGTAATATT
TGATGGGAAACACTGATGATATCTAAAAAAAAAAAAAAAAAAATTTAAAAAAAAAAAAAAAANTCCGGGGGGGGGGGCCGGGCCCCCATT
CCCCCTAAGGGGGGGGTAAATAAAATTTCGGGG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (21)  
mRNA member sequences (56)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 2 | blast: 2 | go: 5 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)