This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U579811, SGN-U580397, and SGN-U592553 in the current build, Tomato 200607 #2
Unigene SGN-U213753

Unigene Basic Information 
Unigene ID: SGN-U213753
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213753
mRNA sequence: Length: 2868 bp

>SGN-U213753 Lycopersicon Combined #3 (55 members)
AACACTCTACTTTGAACGCTGCTTGTAAAATCATCGGCCGGCGACCTCTAAAGTTGAAATTCCGGTGACGGAGACAATGAGGAAGTGGAA
GATCCCGTTCGTCCTGTTTCTGTTATGCCTGATTTACCTTGTTCCAGATCAAGGTCGAAAGATACAGGCAAATGCAGAAGCTGATTCTGA
TGCACCAGTAGATCCACCAAAGGTTGAGGAGAAGTTTGGTGCTGTTCCTAATGGTTTATCGACTGATTCTGATGTGGCTAAGAGGGAAGC
TGAGTCTATGTCAAGGAAAACTCTCCGAGCTAGTGCGGAGAAGTTTGAGTTCCAGGCTGAGGTCTCTCGTCTTATGGACATCCTTATCAA
CTCTCTCTACAGTAACAAGGACATCTTTTTGAGGGAGCTGATTTCCAATGCTTCTGATGCACTGGACAAGATTAGGTTCCTTGCACTCAC
TGACAAGGAGGTTCTTGGTGAGGGTGATAATACTAAGCTTGAGATTCAGATTAAACTTGATAAAGAAAAGAAAATTCTTTCCATTCGCGA
CAGAGGTGTTGGAATGACCAAGGAGGATCTAAGAAAGAATTTGGGAACCATAGCTAAATCTGGAACTTCAGCTTTTGTCGAGAAGATGCA
GACAAGTGGTGACCTTAACCTGATTGGACAATTTGGTGTTGGGTTTTACTCTGTGTATCTTGTGGCTGACTATGTTGAAGTCATCAGCAA
GCACAATGACGACAAACAATATGTCTGGGAATCAAAGGCAGATGGGGCATTTGCCATTTCTGAAGATACATGGAATGAACCTCTTGGCCG
TGGAACTGAAATTAGACTGCATCTAAGAGATGAAGCAGGGGAATATTTGGATGAGCTCAAACTAAAGGAATTGGTCAAGAAATATTCTGA
ATTCATCAACTTCCCTATAAATTTATGGGCAAGCAAAGAGGTTGAGAAGGAAGTTCCTGCTGATGAGGACGAGTCAGTTGATGAAGAGGA
AACATCTGAAAGCACTTCCTCTGAGGAAGAGGGAGAAGAAGAAGATGCAGAGAAGGCCGAAGATGAGAAGAAGCCTAAAACTAAGACAGT
GAAGGAAACCACATATGAGTGGGAGCTTTTAAATGACATGAAAGCTATATGGCTTCGAAGCCCAAAGGAAGTTACAGATGAAGAATATAA
TAAGTTCTATCACTCTCTGGCAAAGGACTTCAGTGAAGATAAACCCATGGCGTGGAGTCACTTCAATGCTGAAGGTGATGTAGAGTTCAA
GGCTGTTCTATTCATCCCTCCTAAAGCCCCTCATGATTTGTATGAGAGCTACTACAACACAAAGCAATCCAACTTGAAGTTATATGTCAG
ACGGGTTTTCATCTCAGATGAATTTAATGAATTGTTGCCCAAGTACTTGAATTTCCTAATGGGTCTTGTTGATTCTGACACCTTACCCCT
CAATGTCTCAAGAGAAATGCTTCAGCAGCACAGCAGTTTGAAGACAATTAAGAAAAAACTCATCCGTAAGGCCCTTGACATGATCCGCAA
ACTTGCCGAAGAGGATCCAGATGAAACTAATGACAAGGAGAAGAGAGATGTTGAAGAGTCCAGTGATGAAAATGAGAAGAAAGGTCAATA
TGCCAAATTCTGGAATGAATTTGGAAAGTCGATTAAGCTTGGTATTATAGAAGACGCAACTAACAGAAACCGCTTAGCTAAACTTCTTCG
ATTTGAGACAACCAAATCAGATGGTAAATTAACTTCACTTGACCAATACATCTCAAGAATGAAATCAAGTCAAAAGGATATCTTCTACAT
CACCGGTGCCAGCAAAGAACAGTTGGAGAAATCTCCCTTCCTTGAAAGACTTAATAAGAAAGACTATGAGGTTATATTCTTCACCGATCC
AGTAGATGAATACCTCATGCAATATCTTATGGACTATGAAGACAAAAAGTTCCAGAATGTGTCTAAAGAGGGATTAAAGCTTAAGGATTC
GAAAACCAAAGAGCTCAAGGAGTCATTCAAGGGGCTAACTAAGTGGTGGAAGAATACTCTTGCTAGTGACAACGTTGAAGATGTCAAGAT
AAGCAGCCGTTTGGCCGACACCCCTTGTGTTGTGGTAACATCAAAATACGGATGGAGTGCATATATGGAGAAAATAATGCATTCACAAAC
CCTGTCAGATGCAAGCAAGCAAGCATACATGCGTGGTAAAAGGGTGCTTGAAATCAATCCTAGGCACCCAATTATCAAGGCACTTCGGGA
GAGAGTAGTAACAGACCCAGAGGACGAGAGTGTGAAGTTGACAGCAAAACTTATATACCAAACAGCTTTAATGGAGAGTGGCTTCGATCT
GAGTGATCCAAAGGATTTTGCCTCCCACATCTACAGCTCAGTAAAGAGCAGTCTAAACATTAGCCCTGATGCAACAGTTGAGGAAGAAGA
AGACGAAGCTGAAGAACCTGAGACTGAAACCAAGGCAGAAGAGGAGTCTGCATCGGATGAGTCTGAACTCAAGGATGAGCTATAGATAGT
GTCCTAAGATATGTTCCTTTTTCCCGGAAACAACACGTTGTTGTGGTATGTTTCTCAACACGTGAAGAATGTAGGAATAGTTTAGTTCAT
AGTCTTAAACTTAAAAAGAATTTTGTCAGTCTTGCATTTTCGTTGTTTTAGTGTATGAGTTTGTCGTTCCGTGTAACAAATCTGGAAGGT
CTTGTTTTTTCCTAATTGGAACTGGTAAAAGCTCTAGTTTTTCTAAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
ACTTGGGGGGGGGGGCCCCCCCCCCCCCCCCCCCCAAGGGGGGGGTTAAAAAATTTCGGGGGGCGGTTTTTAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (25)  
mRNA member sequences (55)  
Alignment image suppressed for unigene with 55 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 1 | blast: 2 | go: 3 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)