Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U574049 and SGN-U574051 in the current build, Tomato 200607 #2
Unigene SGN-U214336

Unigene Basic Information 
Unigene ID: SGN-U214336
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 214336
mRNA sequence: Length: 2071 bp

>SGN-U214336 Lycopersicon Combined #3 (25 members)
TTCTCTCTCTCACTTTCTCTCTCTACCTCAGCTTAAGACATTGAAGAAGACGAAGAACAGCAGCCAAGCAGAAGAATTCTCATATCTATT
TGCTTTGTATTTTTCTCTGTTAATGGATCCATTCAATTATGTTTCGTCCATAATCGAGCTTCGTAAAGGGTTTGGGTGATATTGACTGCA
TAGTTGCGCCATCTTATAATTAGAAGTTTCATGATGTATGTAGACACCCTTTTTTCTTAACCAACTAGAAACAAAACAAAGGAAAAATAA
TAACGAAGAAAAAAGAATGAGCTTATCAGGAAAAGGGACTCCAACCAGTGACAAAAAGCTAACCTTAGCAAAAGCGACAAGCTTGAATCC
AAATGCCGCAGAATTTGTACCCTTTGCACTCAGATCACCCTCAGGTAGCACTAGCAGCACCGATGCATCAAAGTTCGCTAACTCCACTAC
TACTCTTGGAAAAGCTGTACTAGATAGATCAGAATCATCTGCTTCGAACAACTCAGATGATGAAGCACACCAGTATTGGCGTCGCCAGCT
CCCGGATGATATTACACCGGACTTTAATGTCATGGGAGAAGATGATTCTCATGGAATCAGCAGTCTTCCATTTTCTAGATTATCAGTAAC
TGATGTCAATGAAGCTTCAATATTCCCTGCCTCAACTGGCAGTGGCTTCATGTTGAAGGACCAGCTGGAGTTATCTCCTAATCGCATTAA
TGGTACTAGTTTTGTTGAAAAGACAGGATATCCTATTACATCTTTTGGCGAAGATGCATCCTCAACTAGTTTTCATCTGCCTTCTAAACC
CTGGGACAAGCCATCGCTGACTAGTGACCAGCCCTTTGCCAATATTAGGGAGGGGCCTCATTATAACGGGAATTCAGGAAACAGCTTCTT
TGGAGACATGATGAACGAGCAACCATTTTTTGAAGCAGATGTAAACCCTCTTGAATTTTTAGCCTCTCAATTTCCTGGTTTTGCTGCTGA
AAGTCTTGGAGAGGTGTACTATGCCAATGGAGGTGACTTGAATCTGACAATTGAAATGCTTACTCAGCTTGAGCTTCAAGTTGATGGTGG
GTTTAATCAAAATCTGAATTCAAAAGCCTTGTCGGCTCCAAATCTTAGTGCTCTGGATTTCCCTGCTCTTTCTGTGGCAGAAAGTCAAAA
CAGCAGCCTAAAGTACTCTGGCAGTGATGCTCAACAAAATGTCAATCCCTATAGGCCTTCTGAAAAAGAGAGCACCCTTCTTTTTAGATC
TGGCTCTTCCATCCCTTTTCGAGGTGCTACAGATTTTGCATCTGCTGTCAGGAAGATGGCATCTCAGGATTCTAGCATATGGAAGTATGA
TAGGACTGGAGTAGCTGATGGTAGTGTTGGATCAAGTAGAAATTCACCTGTATTGGCTAGCTCTTACAATGGTGGACAGAGTAGGGGAGT
TTATGGTGATAGGTTGCAGAGCCGAGGTTCCACACGTGCAGCTCCTGTCTGGCTTGAAACTGGAGAAGCAGTTGCAAATATATATTCTGA
AATGCGGGAAGAGGCTCGTGACCATGCACGCTTGCGTAATGCATACTTTGAACAGGCACGTCAGGCATATCTTATTGGTAACAAGGCTTT
GGCCAAAGAACTGAGCGTCAAGGGACAACTTCACAATATGCAGATGAAGGCAGCTCATGGGAAGGCTCAAGAATCTATATATCGCCTAAG
GAACCCAGAGATGCAGGGAAATGGAAGAGGACAAGAGAGAATCATAGATCTGCATGGTCTTCATGTTACTGAAGCGATTCATGTCCTGAA
GCGTGAGCTGTCTGTGTTGAGGAATGCTGCCAGATCAGCAGAGCAGCGAATACAGGTTTATATTTGCGTTGGAACAGGACATCATACAAA
GGGTTCGCGTACTCCTGCCAGGCTTCCCATTTCTGTCCAGCGTTACCTTCTAGAGGAGGGCCTTGACTACTCTGAGCCACAACCAGGGCT
TCTCCGAGTTGTGGTATACTGAGGTGTGAAGGTATAGGAGTTTTTGACACGTCATTATCCTAGAAAATCCATCAGATGAAGAAAAAAAAA
A


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (15)  
mRNA member sequences (25)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)