This unigene is from an out-of-date build, Solanum tuberosum #3
It has been superseded by SGN-U269316 in the current build, Solanum tuberosum #4
Unigene SGN-U244269

Unigene Basic Information 
Unigene ID: SGN-U244269
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 244269
mRNA sequence: Length: 1287 bp

>SGN-U244269 Solanum tuberosum #3 (23 members)
CGGCGATTTTGTCTTTAAAGCCCCTCAAAGTTCATATATATATATGTATTCGCCCGGATAAGTTTCTCAGATTCAGACGCCGGTCACCGG
TGCATTCTTCCCGGAGAATTTTCTGATATATAGCCGCCGGTGCCGGTGAATTTGAACAAAAAATGGGGATTGCATGGGACGATGTCGTTT
TGATTGAACACAGAGGGAAATCCGATGAACCGACTTCTATCACCGTAAATTGCCCTGATAAAGCTGGACTTGGATGTGACCTTTGCCGGA
TTGTTCTGGAATTCGGACTCTATGTTACTCGTGGAGATTTTGCCACCGATGGGAAATGGTGTTACATAGTACTGTGGGTTGTGCCACGTC
CAAGCTCGCTAAAGGTGGATTGGGGAAGCTTGAAAAATAGGCTTATGTCTACATGTCCCTCATGCATGATTTCATTTTACCTAAACCAAC
AGTCCACTGCTTCTGCACCGCCTTCAGTTTACCTATTGAAGGTGTTTTGCCTAGACAGGAAAGGATTGCTACATGATGTTACTAAGATCC
TTTGCGAGCTTGAGCTAACAATTCAAAGAGTGAAAGTTATGACAACACCAGACGACAAAGTTTTGGATCTCTTCTTCATAACAGATTGCA
TGGACTTGCTGCACACAAAACAAAGACGAGATGAGACATGTGAACATCTAAGCAATGTTCTGGGAGAATATTGCATTAGCTGTGAACTTC
AGTTGTCGGGGCCTGAATGTGAAGTTCAGCAAGGATTCACTTCTCTTCCACAAGAAGTTGCAGAAGAGTTGTTTAGTTGTGAATTGTCTA
AGGAAGCAGTTCCCATGTCTTCTGCATCTGATACGGCAAAATTAAAGAAGGCAACCATCACAGTGGATAACTTATTGAGCCCAGTCCATA
CGTTGCTTCAAATACAATGCGTTGATCAAAAGGGCCTCATCTATGACATTTTGAGGACTTCAAAGGACTGTGATACTCGGATTGCTTTTG
GAAGAATCCAGTCTACTGCCAAGGGTTATCGTACTATAGACCTATTTATCCAGACAACAGATGGGAAAAAGATTTTCGATGATGAGAACA
TAAAATCTTTGTGTTCTCACTTGAAGGAAGAGATGCTTCATCCACTTCGAGTCACTGTTGGTAGTCGTGGCCCAGATACAGAACTACTGG
TTGCCAACCCCGTTGAGTTATCCGGAAAGGGAAGGCCACGTGTTTTCTATGATGTCACAATTGCTTAAAAGAGCTCGGGATCTGTATTTT
CTCTGCTGAAAATTGCAAGACATTTCA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (23)  
Alignment image suppressed for unigene with 23 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (1)