This unigene is from an out-of-date build, Solanum tuberosum #3
It has been split into SGN-U269558, SGN-U269559, and SGN-U287456 in the current build, Solanum tuberosum #4
Unigene SGN-U244336

Unigene Basic Information 
Unigene ID: SGN-U244336
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 244336
mRNA sequence: Length: 3085 bp

>SGN-U244336 Solanum tuberosum #3 (21 members)
TTACGGTTACGCGTGGATTCATTGCGTGAGATTACTCTTCTTCTTCTTCTCCTGCTTCTGTTTCACCGTTTTTATCGCTCTATACTCTGT
TGAATTGTTCTTCTTCAATTTCTAGGGTTAGGGTTTTGTTATCATCTGTTTTATATCGTATCTATATACTGATTTCGTACTTAAAAAGGT
TCTGCGGGCTTACCTGGAACGATAATCTCTACTCGATTGTATACTGAAATCTCACTCTACCTAGCCATGGCTATGGAGTCATCTATTGTG
ATCAAGGTCAAGTATGAAGAGACACTCAGACGGTTCAATGCTTGTGTCATCAATGAGAAACTTGATCTTGACATTGGTGGATTGAGAGAC
AAGATTATTCAACTTTTCAATTTCGCTCATGATGCTGAACTCACACTAACATATATCGATGAGGATGGGGATGTAGTCACACTTGTTGAT
GATGAGGATCTGCAGGATGTTATGAGGCAGGACCTGAATCCCTTGAGAATATCTGCGAGGTTGAATGCTGGCGAAAGAAGCGGCAGAGCT
TCAGCTAGATCTAGTGGAAATTCTACCCCTTTACGATCACCTCGGGTCCAGCCTCCATTCCTAAACTTGAATTCCCGTGTTTCTGACGTT
CTCAAGTACATTCCAGAACCTCTGCGTGAATCTGTGATGAAGGTCTGTTCTGATATGACTGCATCGGCCTCATCCTCTGCTCCCATCCTT
GCTGAGCTTGTTGATGCTATGTCTGAGATGGGGCTATCTTACTACCAAAATCAGGCTTCAGGGTCTCAGCCTGTCAAAGAAGCTGGCTCC
TGTAGTGGCATATCTAAAGGAAATACTATGAGTGCTGATGGGGGAATGCCAAATGTCAAAATTGGAGAGTCATCCCCAAAGAAGAATGGC
CCTCTCACAGCATTACATGGTGAACCAAAACCTAAGGCCTCCAATGAAGCTGTAGATGCCTCAGTCAAGCTAGTATCTAAATCAGAAACT
TTGGAAGGTGGTCGATCCGAAGCTCTGTCATCATCATTCAAAGGTTCTAAAGCTCAGACTTCACTGGTAAACAGTTTGGAGAAGGATAAG
AAATTTGATGTTCGCAGTCTTGACGGAAGGACTATTGGCTATACATATGTGAGAAACTCACCTATTCCACCAGAAAAGACTTCTGATGAG
CAGCCCAGCAAGGGACATCCGGTAGCTAAGCCGGTTGATTTGGGTGGCTCTGCAAGTTCCAGTAAAGTGAAACAATGCAACTGGGATTCC
CCTAGTGCAGATTCCAGTGGCAGTTCAATCAACATGCCTTATGATGGCTTCACTCCTTCACATCTAGTTCATCTGAACACTGTAAATGTT
AATGATTCCCATAATGCAGGTTCCAGTGGCAGTTCAATGAAGATGCCGTATGATGGCTTCAGACCTGCTGTACGTCATCTATCTCCACTG
ATTCCTGTGAATGCGTGTCCGTTTTCTGGGGTGCCAACAGTAAATAACCCTATTCCACCTCAGAACTTCTCTTTTGAGGTCCCACTTAAA
AGGAGCCATAATCACAGTGATGGGACTGGGACTATTTTCCATAAAGGTGTTCGCTGTGATGGTTGTGGGGTTCATCCGATCACTGGACCT
AGGTTCATATCTAAAGTGAAGGAGAACTATGATCTCTGCAGCATATGTTTTGCTGAAATGGGAAATGATGCTGATTACATCAGAATGGAT
CGTCCTCTAACTTACCCGAATCCCTGGTCTTTCAAGGGTTTACATGATCTGCATGGGAGGTTGCGTCCCCGTCCCCCAACTGTCCCACAA
ATCATTCGAGGCTTTGGGTTGAAAGCAGGTCGGCCGAAGCTGGACAGTCGCTTCATACAGGATGTCAATGTCCTGGATGGAACCATCATG
GCCCCCTTGACTCAATTTACCAAGATCTGGAGAATGAAGAACAATGGTAATCTCGTTTGGCCTCAAGGAACTCAACTTGTTTGGATTGGC
GGTGATAAATTAAGTGATAGATTCTCTGTTGAATTAGAGATATCTACAGCTGGCTTGGCTGTTGACCAGGAGCTTGATGTGGCGGTTGAT
TTTACTGCTCCTGAGCATCCTGGCAGGTACATATCCTACTGGAGGTTGGCTTCGGCTTCAGGACAGAAATTTGGCCAGCGTGTATGGGTG
CTTATCCAGGTCGATGCTTTATTATGCCTGCCAAAAAAGGGGTTGGTCCATGAAGCTTTTCAGGGGTTAAACTTGAATTTACCTCCTGCC
AGCAGTGGTGTGTCTGGACCTGATATTATAAATGTGAATTCAGAACCTCAGAATGTCCTTCCTGAGCCTAAGAGCTCCAGCACAATGGTG
TTGGTTGATTCAGTGGCTGAAGTAAACCAAAACAAGGAGCAGGAGGCCAAATTTCCAATTAATGATAGCTTGTTGGTTGGTTTTGGTGAC
AAGTCAAGTTCTCCATCTGCTTCTGGTTCACCAATTTCATATCCAGTTATTGATTTAACTGAGAAACCATCAGCGGACTCTTCCATGCAA
CCATCATCTGCTGTAGCTATGCAGGCACCGCTCCAGGATGCTAGAGGAAATTTCGAAGTTGAGATGTCTCTCCTCCAGGAGTTGGAGGAA
ATGGGTTTCAAGCAGGTAGATCTGAACAAAGAGATCTTGAGGAAGAATGAGTATGATTTGGAGCAGTCAGTTGATGATCTCTGTGGTGTT
GCTGAGTGGGATCCTATCCTTGAAGAAGCTGAAGGAGATGGGTTTTTGTGACAAGGAAATGAACAAGAAGCTGCTGAAGAAGAACAACGG
AAGCATCAAGCGTGTTGTGATGGATCTTATTGCTGGAGAGCAGTAGAAGATATATATCTATGTCCTATCGTGTGATGGATAGTTTGGTTA
TGAATAAATGGTAGGATGCTACTGTGTGTCTACTATGTGTTGGCTACTGTTCGTCGACTATGATTCGACAAACTCCTTTAAGTTTTGTCA
TTACTTGAACTAGCTATGTAATATAATACTATGGTAGTAGTCGTATCTGGAAACATGTGGTATGTAGTTTTTTAATGAATATGAATGTTT
TTCTTCCTAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (10)  
mRNA member sequences (21)  
Alignment image suppressed for unigene with 21 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 1 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (2)