This unigene is from an out-of-date build, Solanum tuberosum #3
It has been superseded by SGN-U270643 in the current build, Solanum tuberosum #4
Unigene SGN-U244739

Unigene Basic Information 
Unigene ID: SGN-U244739
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 244739
mRNA sequence: Length: 910 bp

>SGN-U244739 Solanum tuberosum #3 (19 members)
CACGAGGATTTGTACAAATCTCCTCATCTCTCTCACAACTCACACACATAGCAGGACTACAGTGAAGCCGGCGGCAAAGAAAACTGAGGA
AGTGAGAAATGCCTGGGATTAGAGGGCCTTCCGATTATTTGCGAGAACCCCCTCGCCATCCTTGCCTTAAAATTAACGCCAAGGAACCTT
TTAATGCCGAGCCAACTCGTTCAGCTCTGATTTCATCTTATGTCACTCCTGTTGATTTCTTCTACAAGAGAAACCACGGACCCATACCAG
TAGTGGATGACATAGAGAGGTATTCCGTTTCTCTGAGTGGTCTTATTAAAAATTCCAAAGACTTGTTTATGAAGGATATTTGTAAGCTTC
CAAAATATACCGTTACTGCCACTTTACAGTGTGCTGGTAACAGAAGAACTGCTATGAGCAAGAGTCGAACGGTGAAAGGAGTTGGTTGGG
ATATTGCTGCTTTAGGAAATGCTGTTTGGGGTGGAGCAAAATTGGCAGATGTTCTTGAATTAGTTGGAATACCTTATTTGACAAGTATCA
CACAATCTGGAGGAAAACATGTTGAATTCGTGAGCATTGACAAGTGTAAGGAGGAAAATGGAGGTCCTTATAAGGCATCAATTCCATTGA
GTCAGGCTACAAACCCTGAAGCTGATGTTCTGCTCGCTTATGAGATGAATGGAGAGCCACTTAATAGGGATCATGGCTATCCACTGCGTG
TGGTTGTCCCTGGTGTGATAGGTGCCCGTTCAGTTAAGTGGCTTGATTACATCAATATCATTGCCGAAGAATGCCAGGGATTCTTTATGC
AAAAAGACTACAAGATGTTTCCACCAACAGTGAACTGGGATAACATCAACTGGTCTACTANGAGACCGCAGATGGACTTCCCTGTTCAGA
GCGCAATATG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (19)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 1 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (1)