This unigene is from an out-of-date build, Solanum tuberosum #3
It has been superseded by SGN-U272214 in the current build, Solanum tuberosum #4
Unigene SGN-U246421

Unigene Basic Information 
Unigene ID: SGN-U246421
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 246421
mRNA sequence: Length: 1513 bp

>SGN-U246421 Solanum tuberosum #3 (9 members)
GAAGATCTGACAATGAAGCAGCACCTTCAATTCTTGAGTCACTGTCCTATGAGGAAGAGGGAGGAGAGTGGAAATTGAGAACACAAAAAA
AAAGGTCCTTTTTTTCACAAAATACAACAACCCATCTTCCTCTTTAGACCCAAAATCTAGGAAAAAAGCAAGATTTTGAGGCTTTTTGAT
AATTTTAGGAGGTGGGTTTGAATTTTTTTTGGGTAAATTTGTAGTGGGATCAAGAATGGTGTGCATAACTGAAGATATGATTAAGCAATT
GCAGACTTCAATGGATGAAATTGCTGAGCCACTTCAGAAGTCTTTCCAGAATGTACATCAGGGGTACCGAACCGAGACACTGGTGAGGTT
TCTCAAAGCTAGGGATGGCAGTGTGTCTAAAGCTCACAAGATGCTTCTTGACTGTTTAAATTGGAGGATAGACAATGAGATCGATCAGAT
ACTTGCAAAGCCAATTGTACCCACTGATTTTTATAGAGGAATGAGGGACACCCAGCTTGTGGGGATGTCTGGATATACAAGAGAGGGTCT
TCCCGTCGTTGCTGTTGGAGTAGGCCTCAGCACATATGACAAAGCATCGATTCACTACTATATTCAATCACATATCCAAATGAATGAATA
CCGTGACCGTATGATATTGCCTTCTGCATCAAAGAAATTTGGGCGGTATATTGGGACCTGTGTTAAGGTTTTGGACATGACTGGTCTAAA
GCTTTCTGCACTAAACCAAATTAAGCTCTTAACTGCTATATCTACCATTGATGACCTAAATTATCCTGAGAAGACAGATACGTATTACAT
TGTTAATGCTCCATACATATTCTCAGCCTGCTGGAAGGTTGTGAGACCTCTTTTACAAGAAAGAACTAAAAAGAAGGTCCAAGTGCTCTC
CGGCTCGGGAAAAGATGAACTGTTGAAGATAATGGATTATGCATCGCTACCACACTTTTGTAAAAGAGAAGGCTCGGGTTCATCTAAACA
TAGTAGAAATGGTACAAATGATAACTGTTTCTCCTTCGATCACGCTTTTCATCAGCAACTCTATGATTATACTAAGCAACAAGCTCTAGC
ATCAGAGGCTGTAGCACCAAGCAAAGAAGGATCGGTCCATGTGACCTTACCTGAGCCTGATCCTGATGATGCAAAGATTGCTGAAACAAT
AGAATCCACATTCCAGAGGATGGGGGAGAAAAACGGAATTTGTCAATCATTTCATGAAATAAAGATCAATGGCAATTGAAGCTGATTCGC
TGTAGTCTTGGTAACTGCTTATTCTGAATCCGGCTTTTACATGACGAGAGGATTTAAGTAAGCGTTGTTATAGTACTAATATGGCTTGCA
TCATCTCGATGCAGGATTTAGTTAGAAGCTAAGTTGTAACATGGCATTTATGCTACCTTGGAGTGGACTATCATATGAATAGTCAAAAAT
GTTAATCCTCCCACGAAGTATTTTACGCGAATTTCGCTGATTTAATCTGATAATACTGCTGCTTAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (9)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (1)