This unigene is from an out-of-date build, Solanum tuberosum #3
It has been superseded by SGN-U298547 in the current build, Solanum tuberosum #4
Unigene SGN-U266209

Unigene Basic Information 
Unigene ID: SGN-U266209
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 266209
mRNA sequence: Length: 617 bp

>SGN-U266209 Solanum tuberosum #3 (1 members)
TTTTATAAGAGAATTTTTTGACCAGAATCCCCTGAGTCAAATTGGCTTGGTGATCTTGAAAGATGGAGTAGCTCATTGCTTAACAGATCT
TGGTGGCAGTCCTGAGGCTCATATCAAAGCATTGATGGGTAAATTGGGGACCTCGGGTGATGCATCCCTTCAGAATGGCCTAGATCTTGT
GTGTGATCTCCTAAATCAAATCCCATCGTATGGTCATCGTGAAGCCCTTATCTTGTATTCAGCTCTTAGCACATGTGATCCAGGGGATAT
ACTGGAAACCATCCAAAAATGCAAAGCGTCCAAGATAAGGTGCTCAGTAATTGGTCTCTCTGCAGAACTCTACATATGCAAGCATCTCTG
CCAAGAAACTGGTGGAATGTATTTTGTTGCATTGGATGAGCCTCATTTAAAAGAGTTGGTATTGGAGCATGCCCCACCTCCTCCAGCTAT
TGCAGAGTTTGCTGTTGCAAATTTGATCAAGATGGGGTTCCCCCAAAGAACAGCAGAGGGTGTCATTTCAATTTGTTCATGTCATAAAGA
GGCTAAAGTTGGCGGTGGATACACTTGTCCAAGATGCAAAGCACGAATATGTGAGCTTNCTACTGAGTGTTGCATCT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E484650
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (1)