This unigene is from an out-of-date build,
Solanum tuberosum #3
It has been superseded by SGN-U273050 in the current build, Solanum tuberosum #4
It has been superseded by SGN-U273050 in the current build, Solanum tuberosum #4
Unigene Basic Information |
Unigene ID: | SGN-U266795 |
Unigene Build: | Solanum tuberosum #3 |
Date: | 2004-07-27 |
Organism: | S.tuberosum |
Alternative ID: | 266795 |
mRNA sequence: | Length: 160 bp |
>SGN-U266795 Solanum tuberosum #3 (1 members)
TAAACAAGTAAACATGTCAATGATTGGATCAAAGTATCTTACTGGCTCATGTGTGTTATTTTGAAGTCTATGATCTCATACTCATTGAAC
TACCACATTGTGAGAATGAATTACAAAGGGTGAATTGTTTATAGCGCTTAGATTGACCAAAAAAAAAAAA
[Blast] [AA Translation]
Associated Loci (0) |
Genomic locations (0) |
![]() |
![]() |

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
![]() |
![]() |
![]() |
![]() |
Gene Family (0) |
![]() |