Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U268251

Unigene Basic Information 
Unigene ID: SGN-U268251
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 268251
mRNA sequence: Length: 1060 bp

>SGN-U268251 Solanum tuberosum #4 (53 members)
AGCAAAAGAGATTTTGAGAGTGGTGGGTGCTGTTGGACAATAGAGATCTACTGATTTCATCCTCTCTCATCGGCCGATCTTCGATTAACG
GAGATGGGGCTGTCTTTCACTAAACTCTTTAGTCGCCTCTTTGCAAAGAAAGAAATGCGAATTCTTATGGTTGGTCTCGATGCTGCTGGT
AAAACCACAATTCTGTACAAGCTCAAGTTGGGAGAAATTGTTACCACTATCCCAACCATTGGCTTCAATGTGGAGACTGTTGAATACAAA
AACATCAGCTTTACTGTGTGGGATGTTGGTGGTCAGGACAAGATTAGACCTCTATGGAGGCACTATTTCCAGAACACACAGGGCCTCATC
TTTGTGGTTGATAGCAATGACAGAGACCGTGTAGTTGAGGCAAGGGATGAGCTTCACAGGATGTTAAATGAGGATGAATTAAGAGAAGCT
GTGTTGCTTGTTTTTGCGAACAAGCAAGATCTTCCAAATGCAATGAATGCGGCTGAAATCACCGACAAACTTGGCCTTCATTCTCTCAGA
CAACGACACTGGTATATCCAGAGTACATGTGCTACTTCTGGAGAAGGGCTATATGAGGGACTGGATTGGCTTTCAAACAACATCGCCAGC
AAGGCCTAATGCAATGATGTGGTACTATGCTTCTTGCGTTGCTATATCCGGAGAAATAAACATCATTGTCTCGTCGTAATTTCTTTCGTT
TGGAGATTTTAAATATCTGTTCAGCTCACAATTCTGGGGAAGGCCTTACCCTTCTTCACTCTCTATGGTTTATCGTCAAAGAGCATGGCA
TAGTTTCCACATTGCTGGATGCACATTGGCAATGTAATGATATTTTAGTATAATATCTGGTTTTGAAACTTGGCGCAGCCGTGTGCACCA
TTTTGTTGTCCGGTGTGTCTGATGTTGGAATGGGTGTACAAAATGCAATACAGATAAATAGTAAGTATCGGAATTTTGCGAGTAGTAAGA
ATATCACCTGAGTTGCTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
DQ228323 ADP-ribosylation factor 1
DQ284463 DQ284463 ADP-ribosylation factor 1
X74461 X74461 ADP-ribosylation factor 1
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (53)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 7 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)