Unigene SGN-U269641

Unigene Basic Information 
Unigene ID: SGN-U269641
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 269641
mRNA sequence: Length: 1452 bp

>SGN-U269641 Solanum tuberosum #4 (29 members)
GGTGTTTGGTTTGTGTGCTTGTGGCCATCATGCGATAAATGAAGGATGGGAGGTCCCCTGTTCCCTACAAATTGAGTTAGCAAAAGAGAA
GGGCCAACCATTGAAGATAAGCAAAGCCGCTATGAGAAACCAAATCGGACACGTGTCCACCTGATATTTCATTCTTGATTTTCCTCAAAA
ATAACAGTTTTCGGTTCTCGTCTTGGAAGTCTCTCAAAAGGGTGGTTGGAATTTTGAGCTGTGGTGCTTTCAAATTGACAAAGTACCAAC
TTTTATCCTCAATTTTCAACAAGGGAAAAGTTTGCTTCAAGAAAAAAAAATAAAAAATCAATGGCGACTGCTTCTTCTTTGGGTTCATCA
ACTCTGTTACAATCCCAAATTAGTGGATTTGGCGGGAGTCAAAAGCTTCAAAAGATTTCTTTCTCCAACCCCAATTCACTCACTTTCACC
AGGAGGAGAATTCAAACTGTGGTGAACGCTTCTTCTCGGGTGGATAAGTTCTCAAAAAGTGACATTATTGTTTCTCCGTCCATCCTTTCT
GCTAACTTTTCTAAATTAGGAGAGCAGGTGAAAGCAATTGAGCAGGCAGGCTGCGACTGGATTCATGTAGATGTGATGGACGGTCGATTT
GTTCCAAATATAACTATTGGACCCCTTGTAGTTGATTCCTTGCGCCCTATCACAGATCTACCATTGGATGTGCATCTGATGATTGTCGAA
CCTGACCAGAGAGTACCTGACTTCATAAAAGCAGGTGCTGATATTGTCAGTGTTCACTGTGAGCAATCTTCTACGATCCACTTGCATCGT
ACAATAAATCAGATTAAAAGTTTGGGAGCAAAAGCTGGGGTTGTCCTCAATCCTGGAACCCCTTTAACCGCAATTGAATATGTCCTTGAT
GCTGTTGATCTGGTGTTGATTATGTCTGTAAACCCTGGATTTGGGGGACAGAGCTTCATTGAGAGTCAGGTCAAGAAAATCTCGGACTTG
AGAAAAATCTGCGCTGAGAGGGGATTAAACCCTTGGATTGAAGTTGATGGTGGAGTTGGTCCCAAAAATGCTTACAAGGTCATTGAAGCT
GGAGCCAATGCCTTGGTAGCTGGTTCTGCTGTCTTTGGAGCTCCTGATTATGCTGAAGCTATTAAAGGGATCAAGAGAAGCAAAAGGCCT
GAAGCAGTTGCTGTATGAGATTTCTGTATGACACAGCGATACGTAGTAGCAAAGCACAAATAGTTGCGAGACTGCAAGCATGGTTCACTC
TGCAACCTACACAAAGAGGATAAATAAAATAACCCACCTCTCGGATGTTGTGTAATACTATATGTTGTATAACTTTTCTTGCATAGGGAA
CAAGATGAATCTGTACTGAATATCCAATTTTCAAGATGACATTTTATAGATGTTAATGAGTTAGTGTCAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Z50098 pentose-5-phosphate-3-epimerasepentose-5-phosphate-3-epimerase
Genomic locations (0)None
Library representation (13)  
mRNA member sequences (29)  
Alignment image suppressed for unigene with 29 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)