Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U270343

Unigene Basic Information 
Unigene ID: SGN-U270343
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 270343
mRNA sequence: Length: 1754 bp

>SGN-U270343 Solanum tuberosum #4 (21 members)
CTGAAACAGACATTATAACAGACACACGGCTAAAACATACACGTATTTATTTCCCTCAAGCAATCGCAATTCGCATCCACACGGCTAAAA
CATACACGTATTTATTTCCCTCAAGCAATCGCAATTCGCATCCACTTAGCAGATTGAAAAAAAAAATGATACCGATAATGAGTTCTGCTC
CTCTATCAACTCCGGCGCCGGTTACTCTGCCCGTCCGTACAATTCCGGGCAGCTACGGATTGCCGTTATTAGGGCCAATCGCCGATCGAT
TAGACTATTTCTGGTTCCAAAAGCCCGAAAATTTCTTCACCAAGAGAATGGAAAAGCACAAAAGCACGGTTTTCAGAACGAACGTACCGC
CGTGTTTTCCGTTTGTAGGCAGTGTGAATCCAAATGTGGTGGCGGTTTTAGATGTGAAATCGTTTTCGCATCTGTTTGATATGGAGATTG
TAGAGAAAGCTAATGTGCTTGTTGGGGATTTCATGCCTAGTGTGGTTTATACTGGAGATATGCGTGTTTGTGCTTATCTCGATACTTCTG
AACCTAAACATGCCCAGATTAAGAATTTTTCACTGGACATTCTAAAAAGAAGCTCAAAAACATGGGTGCCTACACTCCTTAAAGAGCTTG
ATACAATGTTTACAACTTTTGAAGCAGATCTTTCAAAATCAAAGGAAGCTTCTCTTCTTCCCTGCACTCCAAAAATTCCTCTTTAACTTC
TTCTCCCTCACTCTCCTCGGCGCTGATCCATCAGTCTCCCCGGAAATCGCCAATTCTGGCTACATCTTTCTTGATTCATGGCTAGCTATT
CAATTAGCACCTACTGTTAGCATTGGTGTTCTTCAACCCCTTGAAGAAATTTTAGTCCATTCTTTTGCATACCCTTTTTTTCTTGTCAAA
GGTAATTATGAAAAACTCGTTCAATTCGTCAAAAATGAAGCTAAGGAAGTGTTAAACAGGGCACAAACAGAGTTTCAGCTCACAGAACAA
GAAGCCATTCATAACCTTTTGTTCATTCTTGGGTTCAATGCTTTTGGTGGTTTCACCATTTTCTTGCCAACCCTTTTGGGGAATCTTGGA
GATGAGAAAAACGCGGAGATGCAAGAGAAACTAAGGAAAGAAGTAAGAGACAAAGTCGGCGTAAATCCAGAAAACTTGAGTTTTGAAAGT
GTTAAAGAAATGGAACTCGTTCAGTCTTTTGTTTATGAAACACTTAGGCTTAGTCCACCAGTGCCAAGTCAATATGCAAGAGCAAGAAAA
GACTTTAAGCTGAGCTCACATGATTCAGTTTACGAAATCAAGAAAGGGGAACTACTTTGTGGTTATCAGCCATTAGTGATGAAAGATCCA
AAGGTGTTTGATGAACCTGAAAAGTTTGTGTTGGAGAGATTTACAAAGGAAAAAGGGAAAGAATTGCTGAATTATTTGTTTTGGTCTAAT
GGTCCACAGACTGGGAGACCTACTGAATCAAACAAGCAATGTTCTGCTAAAGATATGGTTCCTCTAACTGCTTCTTTGATTGTGGCTTAC
ATTTTCCAAAAGTATGATTCTGTGAGTTTCTCATCTGGTTCACTTAGATCTGTGAAAAAAGCCAGTTGAGTTTTGGGCTGTGTAGCAGCA
AAATTTAAGCTTGCTAGACATGTTGAAATTAAGTCATCAGTGGCTGGCTTTTCTCACCTCCTGTTGTGATTTGTAATATAAATTCTCAAA
TAAAAGTTCAAGAAGAGTGCTTGTTTTCTTTCTAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
hpl fatty acid hydroperoxide lyasefatty acid hydroperoxide lyase
Genomic locations (0)None
Library representation (9)  
mRNA member sequences (21)  
Alignment image suppressed for unigene with 21 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (2)