Unigene SGN-U272973

Unigene Basic Information 
Unigene ID: SGN-U272973
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 272973
mRNA sequence: Length: 1423 bp

>SGN-U272973 Solanum tuberosum #4 (9 members)
CTGCACCAGCTCCAATCTCCGACAGAACCAAACGTCATCGGAAAACTCTTGACGATCTCCGCTCCACTGCCGCCGTTGTTCCTCTCTCCG
GTGAGTAATCTCAATATGACTATTTCCGCAACATTTTCTTCCCATGGAAAAATACTCATGTCACCTCTTAGAAAGAGTGAATGGGCAAAT
CAACCTGTGCTCTGTAAATCTGTTGAATTGTTTAAAAATGGACGAAATCAATACCGTCTGTCAACAAATAGCAACAAATTCCAATGCCGA
GCATTGGAGATCGAAAATAAATCTTCAACTAAGTTTCACCTTGATGATGTAATTGAATCTCAACAATTTGATAGAGAAACTCTTAGTGCG
ATATTTGAAGTAGCACGGGAGATGGAGAAAATCGAGAAGAATTCGATTGGAGGAAGAAGCGAGATTCTTAAGGGTTATCTTATGGCTACT
CTGTTTTATGAACCTTCAACTAGAACTAGGCTTTCATTTGAATCTGCTATGAAGCGTTTAGGAGGAGAAGTATTAACAACCGAAAATGCT
CGTGAATTTTCATCTGCAGCAAAGGGGGAAACACTAGAAGATACAATTAGAACTGTTGAAGGTTACTCTGATATCATTGTTATGAGGCAT
TTCGAAAGTGGTGCTGCTAGAAGAGCGGCGTCAACTGCATCTATTCCGATTATAAATGCAGGAGATGGTCCGGGACAACACCCGACTCAG
GCACTTCTAGATGTGTATACAATTGAACGAGAAATAGGGAAACTCGATGGTATAAACGTTGCTCTTGTTGGTGATCTAGCATACGGGAGG
ACAGTTCGTTCACTTGCTCATTTGCTTGCGATGTATGAAGATGTGAAAATTTACTTTGTATCCCCTGATGTTGTTAAAATGAAGGATGAC
ATAAAGGATTACTTGACATCAATGGGGGTTCAATGGGAAGAAAATGCTGATTTGATCGAGGTGGCTTCTAAATGTGACGTGGTGTATCAA
ACTCGTATTCAAAGAGAGAGATTTGGAGAGAGGGTTGATTTGTATGAAGAAGCTCGAGGGAAGTATATCGTTGATATGAGTGTCGTAAAT
GCTATGCAGAAACATGCTGTAGTGATGCATCCTTTGCCAAGACTTGATGAGATTACTGTTGATGTTGATGGTGATCCGAGGGCTGCTTAT
TTCAGACAAGCTAAGAATGGTCTTTACATTCGGATGGCGCTTTTGAAGCTTCTACTCCTTGGTTGGTGAAAGATGCAAACTTTTTATATT
GCGAAATCGTTCTTGTTGTCTGGATTCTGCTGTTGTTGAATTCAAGAGTTTTGTTAACTTGTTTTAGCATAAAAGAAAATTGAATCTCTT
TCTTTGTTCACAAAATAGTACATTCTATATATGCATTTTAAAGACTTTGAAAGAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
pyrb aspartate carbamoyltransferaseaspartate carbamoyltransferase
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (9)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 7 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (2)