Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U277726

Unigene Basic Information 
Unigene ID: SGN-U277726
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 277726
mRNA sequence: Length: 2086 bp

>SGN-U277726 Solanum tuberosum #4 (467 members)
CCCAAAAAGCCTTAATGGAGCATTTGCTTCCTCGGCTATAAAGTATCAGTCTCTGCATTTGTAAAACCCTAAACGCTTCGCTTATTTGTT
TTGCGCATTCTTCTTCAGCTGTGCCGCATATCGCCTAATTTCTCTTCTCTAAGTTTCTTAGTCTCTCAAGATGGGTAAAGAGAAGATTCA
CATCAGCATTGTGGTCATTGGCCACGTCGACTCTGGAAAGTCGACTACCACTGGTCACTTGATCTACAAGCTTGGTGGAATTGACAAGCG
TGTTATTGAGAGGTTCGAGAAGGAAGCTGCTGAGATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAACTTAAGGCTGAACG
TGAGCGTGGTATCACCATTGATATTGCTTTGTGGAAGTTTGAGACCACTAAGTACTACTGCACTGTGATTGATGCCCCCGGACACAGGGA
CTTTATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGTGCTGTCCTCATTATTGACTCCACCACTGGTGGTTTTGAAGCTGGTAT
CTCTAAAGATGGTCAGACACGTGAACATGCATTGCTTGCTTTTACCCTTGGTGTCAAGCAAATGATTTGCTGCTGTAACAAGATGGATGC
TACCACCCCCAAGTACTCCAAGGCTAGGTATGATGAAATTGTGAAGGAAGTTTCTTCCTACCTCAAGAAGGTCGGTTACAACCCTGACAA
AATCCCATTTGTCCCCATCTCTGGTTTTGAAGGAGATAACATGATTGAGAGGTCTACCAACCTTGACTGGTACAAGGGACCAACCCTCCT
TGATGCTCTCGACCAGATTAATGAGCCCAAGAGGCCAACAGACAAACCCCTCCGTCTTCCACTTCAGGATGTTTACAAGATTGGTGGTAT
TGGAACTGTCCCTGTTGGTCGTGTTGAGACTGGTGTGATCAAGCCTGGTATGGTTGTGACCTTTGGCCCTACTGGTTTGACAACTGAAGT
CAAGTCTGTTGAGATGCACCACGAAGCTCTTCTGGAGGCACTCCCTGGTGACAATGTTGGGTTCAATGTTAAGAATGTTGCTGTTAAGGA
TCTGAAGCGTGGTTTTGTTGCCTCAAACTCCAAGGATGACCCAGCTAAGGGGGCAGCCAGCTTCACTGCCCAGGTCATCATCATGAACCA
TCCTGGCCAGATTGGAAATGGATATGCTCCAGTGCTCGACTGTCACACTTCCCACATTGCTGTCAAGTTTGCTGAGATCTTGACCAAGAT
TGACAGGCGTTCAGGTAAGGAACTTGAGAAGGAGCCTAAGTTCTTGAAGAACGGTGATGCTGGTATGGTTAAGATGATTCCCACCAAGCC
CATGGTTGTTGAGACCTTTGCTGAATACCCACCATTGGGTCGTTTTGCTGTGAGAGACATGAGGCAAACTGTTGCTGTCGGTGTTGTCAA
GAATGTTGACAAGAAGGACCCAACTGGTGCCAAGGTGACCAAGGCTGCCCAGAAGAAGGGAAAGTGAACAGTGCAGTGTGATGCTGGTGT
TTCCAATGCTATTTATTTTCATCGAGTGTGCTATCTAGACTCTGTTTTATTTAGTTCTGCTTTAGTTTGGTCTTTGATTTGCTTATTAGG
TTCTAGTTCTCTGCCTTGTATGTCAAGTACTCATTCTCAGAACTGGGTACTTGATAGGCGGTGGCGAGCATGATTTTGAGTCTGTTTTCT
TTTGCTTTTGTTGAAGTGCCATGGTTTGTTTTCCATGGTGGCTCAGGATTTTTGTTGTTGGTGTTTGCCTAAATTTGAGATCCAAGTTTT
CTACTCAAAAAAAAAAAAAAAAAAAAAAAAATACTTCACTTTTGCTAAAGGTGGTAATTTGATTTTAATAGCGCAGTTCTATAAAGGTGG
GATCAAGTTCAGCCTTAAGGATTTGTATAGGTGAGTGATTTTGTACATGGTAATTCGAAATGGTGAATTGAGGTGANGTGTAGAGTAGAT
TGAACTTGCACCAATAGCGGCACTTTGGCGCTGTAGATTGATTTGAAAGGCAGCCAGNTTAATGTGTATCATTATGTATGTATTGATTGT
TTGATCGNGTAAAAAA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
DQ284495 elongation factor-1 alpha
ef1a Elongation factor 1-alpha
Genomic locations (0)None
Library representation (23)  
mRNA member sequences (467)  
Alignment image suppressed for unigene with 467 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (3)