Unigene SGN-U286885

Unigene Basic Information 
Unigene ID: SGN-U286885
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 286885
mRNA sequence: Length: 591 bp

>SGN-U286885 Solanum tuberosum #4 (1 members)
AAGCAGTTCCTCCAAGTCATTGCATCCCAGTGCATGAAAGACCATCGGATCCAGTTGAAATTGTGGACAATATTCCAGTCATTGATTTGG
GAAAAGCTAATGGTGAAGAACGAAGTGTTGTTGTTAAAGAACTTTTGAAAGCTTTTGAAGAATATGGGTTTTTTCAGATAATCAATCATG
GAGTACCCGTAGATCTAATGGATGAAGCAATGAAAGTGTACAAAGAATTTTTCAGTCTGCCAGCAGCAGAGAAAGCAGAATATGCAAAGG
ATGCAGCTAATGATACAAATAGGGGTGCAGCTACACTGTACAGTAGCAGCGCTAAGCATTATGATTCAGAGGAGCATCGTTACTGGAGAG
ATGTCTTGGAGCATAGCTGCAATCTTGATGGGAAAGACAAAAAAACTTGGCCTAGTAACCCTCCAAGATATAGGTACCTACCTAAACTAT
GCTTAGCAAAATTCCCTCTTGTTATTTTTCTTACCTAGTATTTGCTTGTCCTTTAGGGAGGTTATTGGTGCATATGGAGATGAATTGAGA
AGGGTGAGCAAAGTTATCTTGGGTCTGTTATCTGAAGGGCTAGGTTTGGAG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
h6h hyoscyamine 6-beta-hydroxylasehydroxylase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)