Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U290747

Unigene Basic Information 
Unigene ID: SGN-U290747
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 290747
mRNA sequence: Length: 724 bp

>SGN-U290747 Solanum tuberosum #4 (1 members)
CAAAGATAAGCACTCAGAAATGGCTTCTTCAGTGATGTCCTCAGCAGCTGTTGCCACCCGCGGCAATGGTGCACAAGCCCAGCATGGTTG
CACCCCTTCACTGGCCTCAAGTCCGCCGCCTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATTACCCTCCATTTGCTAGCAATGGTG
GAAGAAGTCAGATGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTCTCATACCTTCCTGATTTATCTGACGAGCAA
TTGCTCAAGGAAGTTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGGTTAACATTGATCTCCTCTGTTTT
TAAAATTTACTAGTTAGTACTAAGTTTTTAATATGTTGTGTTGTGGGATATATATGTGCAGCACGGATTTGTGTACCGTGAGAACAACAA
GTCACCAGGATACTACGATGGCAGATACTGGACCCATGTGGAAGTTGCCCCATGTTCGGGTGTACTGATGCAACCCAGGTCTTGGCTGAG
GTGGAGGAGGCAAAGAAGGCTTACCCACAGGCATGGNATCCGTATCATCGGATTCGACAACGTTCGTCAAGTGCAGTGTATCAGTTTCAT
TGCTTACAAGCCCGAAGATACTAAGTTCTAAAGATAACTAATTGCCCTATTTCTATGGGGACAGTTTGTTTGAATTCTCCTTTGGTTTTT
CCCG


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
bcS2 ribulose-(1,5)-bisphosphate carboxylase/oxygenase S2ribulose-(1,5)-bisphosphate carboxylase/oxygenase
rbcs3 ribulose-(1,5)-bisphosphate carboxylase/oxygenase small subunitphotosynthesis
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)