Unigene SGN-U296943

Unigene Basic Information 
Unigene ID: SGN-U296943
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 296943
mRNA sequence: Length: 671 bp

>SGN-U296943 Solanum tuberosum #4 (1 members)
AAAACACACACACAAACAAAAAAGACAGGGGTGATTTGATCTTAAAGAACATATAGTGCAAAATGGCAAGAAAGTTTAGTACTTTAGTTG
TTTTTGGTGCAATTTTATTTGCTTTATTACAACATGTTTCAATGGCACAACAAACTCATGTTGTTGGTGATACTTTGGCTTGGACCGTTC
CTAATGGTGGCGCTGCCTCTTATTCCACCTGGGCCGCTGGGAAAACCTTTGCCCTCGGTGACGTTCTTGTATTTAACTTTAGAACTGGAT
CACATAGTGTGGCTGAAGTGTCAAAAGGAGCTTTTGATTCATGCAATACTTCAAGCCCAATTTCAATTTCAACTAATGGCCCAACAAATA
TTACATTGACCACTGTTGGATCACATTACTATCTTTGTACATTTCCAAGCCATTGTACATTGGGCCAGAAATTGGCTATTAACGTCTCCG
GCTCCGCGTCTCCCGCTCCTCAGCCAGCCCCCGNCACTCCNACCAACAACAACCCGAGTGAATGGCTCCAAGCCCCATCCGTGTCAGGTC
GCTCCAGCAACGGCACCTGCACCTACTAGTGTAGCCCAAACTTATATTGGTCGGAGATAACTTGGCGCTGGAGTGTTCCTACTAGTGGCC
AAATACTTATCAAAGATTGGGCTAATGGCAAATCATTTCAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
bcp1 dicyanin blue copper protein (bcp1 gene)
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)