Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Coffea canephora #1
It has been superseded by SGN-U618369 in the current build, Coffea canephora #3
Unigene SGN-U303427

Unigene Basic Information 
Unigene ID: SGN-U303427
Unigene Build: Coffea canephora #1
Date: 2005-04-24
Organism: C.canephora
Alternative ID: 121155
mRNA sequence: Length: 721 bp

>SGN-U303427 Coffea canephora #1 (2 members)
TAAGCGTTGGAGATTGGAGATCAATTTCAGCCAAGACGCAGTATTGATGCTTTCTTCAATGAACTTGCCTGATGGCATCCAGAGGCGCCG
AACTGCAGTCGATGAACTCAACATGCGCAGTATATTTGAAGAGAATGACATTGTTTGTGCTGAAGTCCGTGGTTTCCAGCATGATGGAAG
TCTGTACCTACAAGCAAGAAGTCAGAAGTATAGAAAGCTTGATAGAGGTCAATTACTCAGAATCTCCCCTTATTTGGTGAAGAGGCGTAA
ACAACATTTCCACCACCTAGACCAGTATGGAGTTGACTTGATACTTGGCTGTAATGGATTCATATGGGTTGGCGAACATGTTGAAGCCAA
AGATGACATGGTAGTGGATCAAATGATCAAATCTGAGCAAGAAAATGCCAGTTTAAGTGGTTCAGTCAGTTCCTGTGAACAAGAACAAAG
TCACACATCAGTAGAGATTAGGCAACATATATGTAGATTAGCGAATGCAGTCAGAGTACTATCCACTCTAGGTTTCATGGTTACTGTGGA
ATTGATAACTGAGTTAGTTGATTTGAGCATCTCGCATAATCTCAATATACATGAGATGCTTGGGGCAGAATTTTACGTCATTGTTGCTGA
GAAAGAAGCTGAACGTCGAAGCCTGGCAACTAANAAGAGATGAAATCCTGACCCTGTAGTTTAATATTAGTGTCTGATTTATAAATGCCT
A


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (2)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (0)None