Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580929 in the current build, Tomato 200607 #2
Unigene SGN-U312327

Unigene Basic Information 
Unigene ID: SGN-U312327
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 312327
mRNA sequence: Length: 836 bp

>SGN-U312327 Tomato 200607 #1 (69 members)
GTAAAGGAGGGCGGCTCGCTACAGCATCAACCATGGTTCTCAAGACAGAACTTTGCCGTTTCAGTGGTGCCAAGATTTACCCTGGGAGAG
GCATCAGATTTATCCGGTCAGACTCTCAGGTGTTCCTATTCGTCAACTCAAAATGTAAACACTACTTCCACAACAAGTTGAAGCCATCCA
AGCTTACATGGACAGCTATGTATAGGAAGCAACACAAGAAGGATATTGCACAAGAAGCTGCTAAGAAGAGGCGACGTACCACCAAGAAGC
CTTACTCTAGGTCTATTGTGGGTGCAACCTTGGAGGTAATCCAGAAGAAGAGAACTGAAAGGCCAGAAGTTCGAGATGCTGCCAGGGAGG
CTGCTCTTCGTGAAATTAAGGAAAGGATCAAGAAGACAAAGGATGAAAAGAAGGCTAAGAAAGCAGAGGTTCAGGCCAAGTCTCAGAAAG
CTGGAGGAAAGGGCAATATGTCCAAAGGAGGTGCATCAAAAGGTCCTAAGCTTGGTGGTGGCGGAGGAAAACGTTAAGCTGTTGTTTATG
TTGTTTCCTTATTAGCAATAGAGTGCCTTGTTTGAAGAGACTGTAAGCGGAGACCTTCATTTACAAGTATCTCATACATCTGCAGACAAA
TTTCTCGTTGACGGTTTTGCATTTGGTTGCAAATGCAGCTGTTGATTCTCCACATACTATTGACTTCTTGTGGGTTCATTCTCTATTACA
GATGTAGCTTTTTGACTCCTAAACAAAATATTTTTGAAATCTGTTTCTTCGAAAAAAAAAAAGTAATTTACCATGCAGCAATCTGTTTTC
CTGCGTAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (25)  
mRNA member sequences (69)  
Alignment image suppressed for unigene with 69 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 1 | blast: 2 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)