This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580248 in the current build, Tomato 200607 #2
Unigene SGN-U312469

Unigene Basic Information 
Unigene ID: SGN-U312469
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 312469
mRNA sequence: Length: 824 bp

>SGN-U312469 Tomato 200607 #1 (40 members)
CTCAGGTTTCTCTCTCAATAGATCCCTCATTCTAAAAGCTCTTTTCAGGGATCATCATCAAGGAAGCGTGATGGGGCTCACATTCACCAA
GCTCTTCAGTCGGCTTTTCGCCAAGAAGGAAATGCGCATTCTAATGGTTGGTCTTGATGCAGCTGGTAAGACCACCATATTGTACAAGTT
GAAGCTGGGAGAGATCGTGACTACTATTCCTACCATTGGTTTCAATGTGGAGACTGTTGAGTACAAGAACATCAGCTTCACTGTTTGGGA
TGTCGGAGGTCAGGACAAGATCCGTCCATTGTGGAGGCACTACTTCCAGAACACTCAGGGTCTCATTTTTGTGGTTGATAGCAATGATAG
AGACCGTGTTGTAGAAGCAAGAGATGAATTGCATAGGATGTTGAACGAGGATGAACTTCGGGATGCTGTGCTTCTAGTATTTGCTAACAA
ACAAGATCTTCCTAACGCAATGAATGCTGCTGAAATAACTGATAAGCTTGGACTGCACTCCCTCAGGCAGCGTCACTGGTACATCCAGAG
CACTTGTGCAACTTCTGGCGAGGGGCTTTATGAGGGACTTGATTGGCTTTCTAACAACATTGCTAACAAGGCTTAAAGTGATGCAGATTT
GTTATTGTGGGTTGATCCTGGATGCAGGCGGAGTTTTATCTAGTTTTTTTTACTTCTCATGTCAGTGTGGTTATGAATATCATGTTGAAA
GCATTTTGTGTTTCCTTAGGGCTTTTTGTAATGGCTGTGTAATACAATGGTCGAATATATGTAATTGCTGTTTGATTAGGTAAAAAAAAA
AAAAAAAAAACTCG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (21)  
mRNA member sequences (40)  
Alignment image suppressed for unigene with 40 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 7 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)