This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U578505, SGN-U579405, SGN-U591971, and SGN-U592210 in the current build, Tomato 200607 #2
Unigene SGN-U313211

Unigene Basic Information 
Unigene ID: SGN-U313211
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 313211
mRNA sequence: Length: 1055 bp

>SGN-U313211 Tomato 200607 #1 (203 members)
CTTTTACATATCAAACTAGCAACTCCCTCATTTTCCTCTCTTTAAAAACCATGGCAGCTGCTACAATGGCTCTTTCTTCTCCTTCTTTTG
CCGGACAGGCAGTGAAACTCTCACCCTCTGCCTCAGAAATCTCTGGAAATGGAAGGATCACCATGAGAAAGGCTGTTGCCAAGTCTGCCC
CATCTAGCAGTCCATGGTATGGCCCTGACCGTGTTAAGTACTTGGGCCCATTCTCTGGTGAGTCCCCAAGCTACTTGACTGGTGAATTCC
CTGGTGACTACGGCTGGGATACCGCTGGACTCTCAGCAGACCCTGAAACCTTTGCCAAGAACCGTGAACTCGAGGTGATCCACTGCAGAT
GGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTATTGGCCCGTAACGGTGTCAAGTTCGGTGAGGCTGTGTGGTTCAAGGCCG
GATCCCAGATCTTCAGCGAGGGAGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAGAGCATCTTAGCCATCTGGGCTTGCC
AAGTTGTCTTGATGGGAGCCGTTGAAGGTTACCGTATTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCACTCTACCCCGGTGGCAGCT
TCGACCCATTAGGCCTTGCTGAAGACCCCGAGGCATTTGCTGAGCTCAAGGTAAAGGAGATTAAGAACGGCAGACTTGCTATGTTCTCTA
TGTTCGGATTCTTTGTTCAGGCCATTGTTACCGGAAAGGGTCCATTGGAGAACCTTGCTGACCACCTTGCAGACCCCGTTAACAACAACG
CTTGGGCTTTCGCCACAAACTTTGTCCCCGGAAAATGAATATCATAATATATTTTTTGAATTTTGATTGTTTGATGGCCCTGTAAAGTAG
TTGTGACTTCATAGAATGGATTTTTTTTTCAAAAAAAAAAAAAAAAAAAGTAGTTCTGAGTTACATTTTCCAAAGCTATGAATCAAATAT
TGCCACTTTCATACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (21)  
mRNA member sequences (203)  
Alignment image suppressed for unigene with 203 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (6)  
Annotations (manual: 3 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (4)