This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U581507 and SGN-U591163 in the current build, Tomato 200607 #2
Unigene SGN-U313265

Unigene Basic Information 
Unigene ID: SGN-U313265
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 313265
mRNA sequence: Length: 989 bp

>SGN-U313265 Tomato 200607 #1 (44 members)
GAACTGAAAAAGCCAGAGGAAAAATGAAGTTCAATATTGTATCACCCGTTGCACTGTCTTGTCTCTTTTTCTTGTTCCTAACAGGTACTT
TAGCACAAAATGCCGGTTCCATTGTAACGCGGGAATTGTTCGAACAAATGCTGAGTTTTAGGAACAATGACGCATGTCCTGCCAAAGGAT
TCTACACTTATGATGCATTCATAGCTGCAGCCAATTCGTTTCCAGGTTTTGGTACTGCTGGTGATGATACTGCACGTAAGAAGGAAATTG
CTGCCTTTTTCGGTCAAACATCTCACGAAACTAATGGTGGTAGTGCAGGAACATTCACTGGAGGATATTGCTTTGTTAAGCAAATAGAGC
AGTCAGACAGATACTATGGCAGAGGACCTATCCAATTGACACACCAATCTAACTACGAACGAGCTGGACAAGGTATTGGTGTTGGACAAG
AGTTAGTGAACAACCCTGATTTAGTTGCGACAGATCCTATAATATCATTCAAAACAGCAATATGGTTCTGGATGACAGAACAGGATAATA
AACCATCATGCCACAACGTTATCATTGGACAATGGACGCCATCCCCTAAAGATACAGCAGCTAATAGAGTTCCAGGGTACGGTGTCATTA
CCAACATCATTAACGGTCAATTTGAATGTGGGATGGGTCCGAATACTGCAGCGGAAAGTCGAATTGGATTTTACAGGAGGTATTGTGGTA
TGTTGAATGTTCCTACTGGTGAAAATTTGGACTGTAACAATCAAAAGAACTTCGCCCAGGGCTAAGCGTCTTTATTTATATATAGAGAGA
GAATGCAAATTATGTTTATGTATTACGTTGTGAAGTCTATAAGTTATATTTGGATGTAATCAATAAGGGGATTCTGTATGCCCATTTAGA
AAAATGGAAGTTTATTTTCAGAAATACTAAAGTTATATGATTTTGATCTTTTGTTATAAAAAAAAAAAAAAAACTCGAGACTAGTTCTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Z15141 acidic extracellular 26 kD chitinase
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (44)  
Alignment image suppressed for unigene with 44 aligned sequences.
[Show Image]
Markers Information (2)  
Expression Data (12)  
Annotations (manual: 5 | blast: 2 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)