Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578263 in the current build, Tomato 200607 #2

Unigene SGN-U313418

Unigene Basic Information

Unigene ID:	SGN-U313418
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313418
mRNA sequence:	Length: 1785 bp

>SGN-U313418 Tomato 200607 #1 (90 members)
CGATTGGCGGCCAATCGGCCGTCTCTCAATCAATATCAGGTTCTTCTTTCTCTCTTTGTATCTCTTTTTCTCTCTCATGGTGATGGTATC
ATCTCCGCCACAATTTTTATCGGAGGACCGCCGGTGATCGGTGTTTTTCTCCGTCTCCTCAACATTTTGATTCTTTCGGTGAATGACCTT
TTGTGGTGATAACTAGTAAGCAGACTTTTCTTGGAAATGGCTTCCGTGGGCTTAGCACCTACATCGGGTTTGAGAGAATCCAGTGGCCAT
AATGCTGGGGTAGATAGGTTGCCTGAGGAGATGAATGACATGAGAATCAGGGATGATAAGGAAATGGAAGCAGCAATTGTTGACGGTAAT
GGGACTGAGACAGGCCACATAATAGTGACAACTATTGGTGGTAGAAATGGCCAGCCAAAGCAGACTATTAGTTACATGGCTGAACGTGTT
GTTGGACAAGGATCCTTTGGGGTGGTGTTTCAGGCAAAATGCTTAGAGACTGGTGAAACTGTTGCTATTAAAAAGGTTCTTCAAGATAAA
AGATATAAGAACCGAGAATTGCAGACAATGCGCCTTCTTGACCACCCTAATGTTGTGTCTCTCAAACACTGCTTCTTTTCCACAACTGAC
AAGGATGAACTGTATCTTAACTTGGTTCTTGAGTATGTACCTGAAACCGTTCACCGTGTTATCAAACACTACAATAAGCTGAATCAAAGG
ATGCCGTTGATACTTGTGAAGCTTTATACATATCAGATTTTCAGGGCATTGTCTTACATACACCGCACTATTGGAGTGTGCCACAGGGAC
ATTAAACCTCAGAATCTTTTGGTGAATCCACATACCCACCAGGTTAAATTATGCGATTTTGGGAGTGCCAAAGTTCTGGTTAAAGGAGAA
CCAAATATTTCTTACATCTGTTCTAGGTATTATCGAGCACCTGAGCTCATATTTGGTGCAACAGAGTACACTACTGCTATAGATGTTTGG
TCTGCTGGCTGTGTCCTAGCTGAGCTACTTCTTGGTCAGCCATTATTTCCAGGTGAAAGTGGAGTTGATCAGCTTGTTGAGATCATTAAG
GTTTTAGGCACTCCTACAAGGGAAGAAATTAAATGTATGAATCCCAACTATAATGAGTTCAAATTTCCTCAAATTAAAGCTCATCCATGG
CACAAGATATTTCATAAGCGCATGCCTCCAGAAGCAGTTGATCTGGTCTCAAGACTGCTTCAGTACTCTCCTAACTTGCGCTGTGCTGCT
TTGGATGCCTTGGTTCACCCATTTTTTGACGAGCTTCGTGATCCCAATACACGCTTGCCTAATGGACGCTTTCTTCCTCCCTTGTTTAAC
TTCAAGGCTCATGAGTTGAAGAATGTGCATGCAGAGATATTACTGAAGTTGGTTCCAGAGCACGCCAGAAAACAGTGCCCTTCCCTTGGG
TTATGAGTTCCTGCCTTGTGATAGAAATAATTTAAGTGTACCCTTTGAAGCTGTGTTTCTTCTCTGTATCAATTTGTTCCTTCTTTCCCT
TATCTTACCATGTCTCTGTTGTCCCTTTGTATTATTATTATTATATCTTGTTTTGTAAAAGCAGATGTAGGGAATTGATCTTTAACAAAT
ACCCGATGTTCAACCTGTGTTCCTTTTTACCCTGTTCCGATATATCCTATGCTTGTAACATTATGTGGTTGAGAATTAACAATTTGAGTG
AACGTTATTATTATGGGATTGCAAATTAATGATAGGGTGACTGTTGATATGGCTCCTAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (27)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPP	pollen pollen collected from open flowers	5426	6
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	2
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	8
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	3
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	5
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	20
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	3
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	2
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	3
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	3
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	3
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	2
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	5
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	6
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	2
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	3
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	1
Solanum lycopersicum	cTOS	suspension cultures	8026	2

mRNA member sequences (90)

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]

Markers Information (0)

Expression Data (5)

Annotations (manual: 4 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101361	Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Protein kinase-like	1515
2	118420	Protein kinase-like Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468)	253
5	129072	Protein kinase-like Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Serine/threonine protein kinase - Molecular Function: protein serine/threonine kinase activity (GO:0004674) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Serine/threonine protein kinase active site - Molecular Function: protein serine/threonine kinase activity (GO:0004674) - Biological Process: protein amino acid phosphorylation (GO:0006468)	47

Preceding Unigenes (2)

Unigene	Build
SGN-U213449	Lycopersicon Combined #3
SGN-U213450	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer