Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U564570 and SGN-U564571 in the current build, Tomato 200607 #2

Unigene SGN-U313450

Unigene Basic Information

Unigene ID:	SGN-U313450
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313450
mRNA sequence:	Length: 1664 bp

>SGN-U313450 Tomato 200607 #1 (78 members)
TCGGCCGAATTGACACACTACACAACCATGGCTTCAATTGCTCTCAAAACTTTCATCGGCCTCCGTCAATCCTCGCCGGAAAACAACTCT
ATTAAAATCTCTAAATCCCTCCCTACCAACCACACCCACCGTAGGCTACGTATCAATGCTTCGAAGTCCAGCCCAAGAGTCACCGGCAGA
AACCTTCGCGTTGCGGTGATTGGTGGTGGTCCTGCTGGTGGCGCCGCTGCAGAGACGCTCGCTAAGGGTGGAATTGAGACCTTTTTGATA
GAACGCAAGATGGACAACTGCAAACCCTGCGGTGGTGCCATCCCACTCTGCATGGTGGGCGAATTCGATCTACCTCTCGATATCATCGAT
CGGAAAGTTACCAAGATGAAGATGATTTCCCCATCCAACGTCGCCGTCGATATCGGACAGACTCTGAAGCCTCACGAGTATATCGGTATG
GTGCGCCGCGAAGTACTCGATGCCTACCTCCGGGACCGTGCTGCTGAAGCCGGAGCTTCTGTTCTCAACGGCTTGTTTCTCAGAATGGAC
ATGCCAAAAGCCCCAAATTCACCATACGTCCTACACTACACATCTTACGATTCCAAAACTAACGGCGCCGGTGAGAAGTGCACCCTGGAA
GTTGACGCCGTTATCGGCGCAGACGGCGCAAATTCCCGTGTCGCAAAATCCATCAACGCTGGGGACTACGAGTACGCCATTGCCTTCCAG
GAACGAATTAGAATTTCCGATGATAAAATGAAGTACTACGAGAATTTAGCTGAAATGTATGTCGGCGATGACGTATCCCCTGATTTTTAC
GGTTGGGTTTTCCCTAAATGTGACCACGTTGCCGTCGGCACAGGCACCGTTACCCACAAAGCAGACATTAAGAAATTCCAGCTAGCCACA
AGACTGAGAGCCGATTCCAAAATCACCGGCGGAAAAATCATCCGAGTTGAGGCTCATCCAATTCCAGAACACCCAAGGCCAAGAAGATTA
CAAGACAGAGTCGCATTAGTTGGGGATGCAGCAGGATACGTGACGAAATGTTCAGGCGAAGGGATCTACTTCGCGGCGAAGAGTGGACGT
ATGTGTGCTGAAGCAATTGTTGAAGGATCAGAAAATGGGAAGAGAATGGTGGACGAGAGTGATTTGAGGAAGTACTTGGAGAAATGGGAC
AAGACTTACTGGCCAACATACAAGGTGCTTGATATCTTGCAGAAGGTATTTTACAGGTCGAATCCAGCAAGAGAAGCTTTCGTGGAGATG
TGCGCTGATGAGTATGTGCAGAAGATGACATTCGACAGCTATTTGTACAAGAAAGTTGCACCAGGAAACCCCATTGAAGACTTGAAGCTT
GCTGTGAATACCATTGGAAGTTTGGTGAGGGCTAATGCACTAAGAAGGGAAATGGACAAACTCAGTGTATAAGAAGAGGATAAAATTTCA
TAGTAGCTAATATTTTGTAAACTTGATTTGTAATTGAAGTATTTATGCCTTTTATCGAATTTCAAAAAAAAAAAAAAAAAATTCCTGTCA
ATGTTGTTGAAGCTAGTTTAAACTTCGAATTTGGACTAAACTTCTAAAGCTTAGATAAGTGAATAATGAGATTGTACTGATATATGATTT
TATACAGGAAACAAAGATTAATTTTTTTTAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (21)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	2
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	4
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	LA	Leaf Mature leaves	6589	18
Solanum lycopersicum	LB	Leaf Mature leaves	3316	4
Solanum lycopersicum	LC	Leaf Mature leaves	5712	3
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	9
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	4
Solanum lycopersicum	cLER	leaf 4 weeks	5127	4
Solanum lycopersicum	cLES	leaf 4 weeks	5243	4
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	5
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	5
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	3
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	4
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (78)

Alignment image suppressed for unigene with 78 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (8)

Annotations (manual: 3 | blast: 2 | go: 7 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102037	FAD-dependent pyridine nucleotide-disulphide oxidoreductase Geranylgeranyl reductase plants and cyanobacteria Geranylgeranyl reductase - Biological Process: photosynthesis (GO:0015979) - Biological Process: chlorophyll biosynthesis (GO:0015995) - Molecular Function: geranylgeranyl reductase activity (GO:0045550) Aromatic-ring hydroxylase - Biological Process: electron transport (GO:0006118) - Biological Process: metabolism (GO:0008152) - Molecular Function: oxidoreductase activity (GO:0016491) NAD-binding site Geranylgeranyl reductase plantal and prokaryotic	24
2	119574	Geranylgeranyl reductase - Biological Process: photosynthesis (GO:0015979) - Biological Process: chlorophyll biosynthesis (GO:0015995) - Molecular Function: geranylgeranyl reductase activity (GO:0045550) NAD-binding site FAD-dependent pyridine nucleotide-disulphide oxidoreductase Geranylgeranyl reductase plants and cyanobacteria Aromatic-ring hydroxylase - Biological Process: electron transport (GO:0006118) - Biological Process: metabolism (GO:0008152) - Molecular Function: oxidoreductase activity (GO:0016491) Geranylgeranyl reductase plantal and prokaryotic	14
5	129904	Geranylgeranyl reductase - Biological Process: photosynthesis (GO:0015979) - Biological Process: chlorophyll biosynthesis (GO:0015995) - Molecular Function: geranylgeranyl reductase activity (GO:0045550) NAD-binding site FAD-dependent pyridine nucleotide-disulphide oxidoreductase Geranylgeranyl reductase plants and cyanobacteria Aromatic-ring hydroxylase - Biological Process: electron transport (GO:0006118) - Biological Process: metabolism (GO:0008152) - Molecular Function: oxidoreductase activity (GO:0016491) Geranylgeranyl reductase plantal and prokaryotic	14

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U214067	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer