This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U577417, SGN-U577424, SGN-U577612, SGN-U579271, SGN-U579650, SGN-U579831, and SGN-U581206 in the current build, Tomato 200607 #2
Unigene SGN-U314329

Unigene Basic Information 
Unigene ID: SGN-U314329
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314329
mRNA sequence: Length: 3877 bp

>SGN-U314329 Tomato 200607 #1 (162 members)
TTTTGCTCAAATATCTGTATACTCTCTCCGCCATTTTCACAAAATTCTTCATTTCTTAAAAACCCTAACTTACCTTTTGGCTACGGATGA
CGACGTCGTTTGGAGCAGCGATCAATATCGCCGCCGTCGATGACCCCAACCCGAAGCTACAAATTCAGAGGTTCAATGGATTGAAAAGCA
CCTCTAATTCGATTTTGCTTAGCAGACGTATCCATCGCTCATTTTCTCATTCCAATTCTACTTCTATTGTCCGTGCTGTATCTACGCCAG
CGAAGCCAGCTGCGGTGGAGCCCAAGCGTAGTAAGGTTGAAATCTTCAAAGAACAGAGTAACTTCATAAGATATCCTCTAAATGAGGAGA
TTCTTAATGATGCCCCAAACATCAATGAGGCTGCAACACAATTGATTAAGTTTCATGGAAGCTATATGCAATACAACAGAGACGAGCGTG
GATCAAGATCATACTCATTTATGCTTCGGACAAAGAACCCTGGTGGTGAAGTACCGAACAAACTCTACTTAGTCATGGATGATCTTGCTG
ACCAATTTGGGATTGGGACACTCCGTTTGACAACAAGACAGACCTTTCAGCTGCATGGGGTCTTGAAGAAAGACCTAAAGACAGTAATGA
GTACAATCATCCACAACATGGGTTCAACTCTTGGTGCATGTGGTGACCTCAACAGGAACGTTCTGGCTCCAGCTGCCCCATTTGCAAAAA
AAGATTATGTTTTTGCTAAACAAACAGCTGACAACATTGCAGCACTTTTAACTCCCCAGTCTGGATTTTACTATGACGTTTGGGTGGATG
GGGAGAAATTTATGTCAGTAGAACCTCCTGAAGTTGTGAAAGCTCGGAATGATAACTCCCATGGAACGAACTTTCCTGACTCACCTGAAC
CCATTTATGGAACTCAGTTCTTGCCAAGAAAGTTCAAAATCGCAGTTACTGTGCCAAGTGATAACTCGGTGGACATTTTCACGAATGACA
TAGGTGTTGTTGTTGTATCTGATGAGGATGGAGAACCTCAGGGATTCAATATATATGTAGGTGGTGGTATGGGACGAACTCATAGGATGG
AAACTACTTTTCCTCGTCTGGCTGAGCCATTAGGTTATGTTCCTAAAGCGGATATACTTTATGCAGTTAAAGCTATTGTTGTTACTCAGA
GAGAGAATGGGAGAAGAGATGATCGCAGATATAGCAGATTGAAATATTTACTCAGTTCATGGGGGATTGAGAAGTTCCGATCTGTCACTG
AACAATATTACGGAAAGAAGTTTGAACCCTGCCGTGAATTGCCTCAATGGGAATTTAAAAGTTACTTGGGATGGCATGAACAGGGAGACG
GTAGTTTGTTTTGTGGTCTACATGTTGACAATGGTCGTGTAAAAGGAGAGATGAAGAAGGCACTCAGGGAAGTTATTGAGAAGTATAATC
TGAATGTGCGTCTCACACCCAACCAAAATATTATCTTGAGCAATATTCGGCAATCTTGGAAGCGCTCCATCACCACAGTCCTTGCACAGG
GTGGTTTGCTGCAACCTAGGTTTGTCGATCCTCTCAATCTAACAGCAATGGCGTGCCCAGCTTTTCCACTTTGTCCTCTAGCAATCACTG
AAGCTGAGCGTGGAATACCTGACATCCTCAAGCGTGTTAGAGCTATGTTTGACAAGGTTGGTCTGAGGTTCTATGAATCCGTTGTTATAA
GGGTAACAGGTTGTCCCAATGGATGTGCTCGACCATACATGGCTGAACTTGGATTGGTTGGAGATGGTCCAAACAGCTATCAGATCTGGC
TCGGTGGAACTCCCAATCAAACTGTATTGGCAAGAACTTTCAAGGATAAGGTTAAGGTTCAGGATCTTGAAAAAGTTCTGGAGCCTTTAT
TTTTCCATTGGAAAAGAAAGCGACAATCTAAAGAATCGTTTGGGGAGTTCTCAAACCGCTTGGGATTTGAGAAACTAGGGGACTTGGTTG
AGAAATGGGATGGCATCCCTGAGTCATCATCTCGTTATAACTTAAAGCTATTTGCTGATAAAGAGACGTATCAAGCCATGGATGCACTTG
CAAGAATACAAAATAAGAATGCCCATCAATTGGCGATTGATGTAATTCGCAATTATGTTGCTTCCCAGCAAAATGGGAAAAGCATGGACT
GACCAAGTCATCTTTTGTGTTGCAAAACAGTAAAGATAATGGCAAGGAGATTTAACTGGTGACTACGTCTTCGTCTTGAAATTGCTTGGC
TGAAACAAGTGGAGAATTTTGACATAATGTTGTGCAAGCTTTTATAGTACTTCACTCGTAGAGCTGACAGTACACTGCATTTTTCCTTTC
TATTTTTCGTTGTTCATTTCCCAGTTCCTTTTCATGAGCAAACAAAATCTGATAATGGCCTGTATCTTATTTTCTTTCAAATTAGTTTTT
GAAAGGGTGCCGAATTCGGCACGAAGAAAACAAAGAATGGGTTCCAAAGCATTTCTGGTTTTTGGTCTTTTTTTGGCTATTTTCCTAATG
ATAAGCTCTGAGATTTTAGCTACTGAGTTGGCTGAGACTTCTAAGAAATCTGATAACAAGAATGAAGTACATGAAGCCCAATATGGTGGA
TATGGACGCGGTGGTGGTGGATATGGACGCGGTGGTGGTGGAGGATATGGACGTGGTGGTGGATACGGACATGGTGGTGGTGGTGGATAT
GGACATGGTGGTGGTGGATATGGATACGGTGGTGGATACGGACACCGTGGTGGCGGTGGTGGTGGACGACGTGGTGGATACTGCCAGTAT
GGTTGCTGTGGCCATGGTGACAATGGTTGCTATAGGTGTTGCTCCTATAAAGGTGAGGCAATGGACAAAGTTACTCAAGCTAAGCCACAC
AATTAATTAATTATGTGTGGAGTACGTAGTATATTATATTAAAACTTTTGTAATGGCAATTATGTAATATTATTAGCAATGCTCTTTCTA
CTTTAGAGCTTGCTATAATATTAGTAAAAATGTATTGAATAAAAGCCATGTTGTAGTAATTTTATTATCAATATTTTATTATGATATTCA
TATTTAAAAAAAAAAAATAATACCAAAAAGTTCTAGTTCTTTTTAAAAAAAAAAAAAATAATTTCTGAGATAGAAATTAAGTGTGATGGA
GATATTTTTTATGAAGTATATAGGCACAGGCCACACCATATCTCCACCATGTCCCCTAATAACATACAAAATGTGGATGTTCATGAAGGT
GAATGGGGCACAATTGACTCTGTTATCTTTTGGAACTTCATCCATGATGGGAAAGAAGTGCTGGCAAGGGAGAAAGTGGAAGAAATAGAT
GAAGAAAAGAAGCTAATTAAAAAAAAGATAATTGAAGGAGATATATTGGAGTATTACAAATCATTTTACATCACTGTTCATGTTGAGACA
AAGGGCGAAAATAATTTAGTTACTTTGACCATAGAATATGAAAAGAAAAATGCTAATGTGCCAGATCCACACACATTCATGGAATTACTC
CTCAATGTAACCAAAGATATTGAGAATTACCACATCAAGTGATACATAAATATTATACACAAGGACTCTTTGAAAATATCGACAAGTATA
TGTCGAATTTTTTAAAATACTGTATTTTGAAGAAATCGATATAAATATGATAATATTTTTGAATAGTTGAAATAATGTATACCAAATGCT
TGGATTTAAGCTGTTTCAAAGTCTTGTAATAATATGTGTTGTTATTAGCGGGTGTGCTTTGAAATATCTTGTAACAAAAATAAAACGAGC
GAATATCTAATTTTTATAGATAACTAAAAAAAAAAAGTTGTTATTTTAAAGGCACTATAGTTTTTCTTTCTTTTTTAAAAAAAAAAAAAA
AAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (21)  
mRNA member sequences (162)  
Alignment image suppressed for unigene with 162 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 1 | blast: 2 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (2)