This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U579250 and SGN-U581328 in the current build, Tomato 200607 #2
Unigene SGN-U314590

Unigene Basic Information 
Unigene ID: SGN-U314590
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314590
mRNA sequence: Length: 2413 bp

>SGN-U314590 Tomato 200607 #1 (26 members)
AATTCTTGTTCAGTGTAAAGTTGAACAAGAATTTGATCATCCATAATGGAAGCCTCTGCCGGAGTTTTACGCCGATTTCCTTCAGTCACC
GGCGCCGGTGTCGGAGTTAGCAGCAATCCGTTGAATCGTAGTTGTAGTGTTTCACGTGTTAGTTTGAAATCAATGGGTTGTGGGTTTTAC
GATGAGGGTTGTTTGGAGTATTATTCATCTGGTAGAGGTGGAATTATTAGGTGTGGGAAGAAGAAGAACAAAGAGAAGGATATGGCGGAG
TTGAAGAAAACGAAGAAGAAGATGAAATTACTTAAGGGTTTGACGAAGAATTTGTCGAATTTGAATGGGATGGGATTAGGGTTCGGTTGT
GATGTTGATTTGGTTGATCAAGTTCAAGGGAAGACAATTTCGGAGGCGGCGGAGCTATTGTTGGGACAGCTTCAACAGTTGAAGGCAGAG
GAGAAGGAGTTGAAGAGGAAAAGAAAAGAAGAAAAAGCACAAATGAAGATGAAAGTAGCAGCAAGTGAAGTGCAGAGCAACACAAGGAGC
TGTGCAATGTCATCATCTTCAAGCTCGTCTTCAGAATCGAGTGATTCAAGTGATGATGAATGTCAAAATTTGGTTGACATGAAAAGCCTG
AAAATCGGAACACTTGCTCAAACAATTCCTGAAGCGTGTGATCGAGCACTTGATAATGCAACACTAAACCCTTCCCTTTCAACTCCAGAA
GTCGATACAACAGTAGAGATCTCAAGCATGCCATCAACTACCACGGAGGAATCAACTGGGAAGACGACAAGTTTTGAGTTTTCAGTCCCT
GAACAAAAAGGCGAATGCTGCTTGGAAGCTAGTGATTGTCACATTGGCAATGTAGGCAGCAGTATCACACCAGGCACTAGGTCTAATGTA
TCATCTATAGCAGCAGCTACAACGACAACAGCAGAGGGTACAAAGAGAATCGAAGTATGTATGGGTGGTAAATGCAAGCGATTGGGCGCT
GGAGCGTTACTAGAAGAATTCCAACGCGTTGCTGGGATTGAAGCTGCAGTCTCTGGTTGCAAATGCATGGGAAAGTGTAAAGTTGGTCCT
AATGTCAAAGTTTCAGGGTGTAGCAGCAGCAGCATCTCGGACGCCTTCCAAGCCGGTGACTCGGTTGCTGTTAGCTCTGCTCCAACTACA
AGTAACTCTCTATGTATTGGGGTTGGTTTAGAGGATGTGAGTCTAATTGCAGCCAATTTACTTGGCAGATATCAAGAAGTAGGCTTGGCC
AATGCTTTGCCTTAAATCTTTTTTTCTTTCATTAGCAATATAGTAGGTAGGTTTTTTTGGGATTTTGGCAATGAGTTTGAATCTTTTTTT
GTAATGTAAATATCAGCAATATAGATAAAGTTTGCTAAAAAAAAAAAAATTATCATTATATACAGATATGGACCTTTTGTATCTCTCAAG
TACCCGATCTTGACGAAGAATACAGAGAGGTGATGAGAGATTTTGCTAAAAGATTGGAGAAATTGGCTGAGGAGTTACTTGACTTACTCT
GTGAAAATCTTGGACTTGAAAAAGGTTACTTGAAAAATGCCTTTTATGGATCAAAAGGTCCCAACTTTGGTACTAAAGTTAGCAACTATC
CACCATGTCCTAAGCCCGATTTGATCAAGGGACTCCGCGCTCATACAGACGCAGGAGGCATCATACTTCTGTTCCAAGATGACAAAGTGA
GTGGCCTTCAACTCCTCAAAGACGAGCAATGGATCGATGTTCCTCCCATGCGCCACTCTATTGTGGTTAACCTTGGTGACCAACTTGAGG
TACAAGATTCACTAAGTGTGTGTGTTTTTATCACTATAACTTAGAAGTAGTAACTAAAAATGGTATTAATGAAATGTTATAAAAACAGGT
GATCACTAACGGGAAGTACAAGAGTGTGCTGCACAGAGTAATTGCACAAACAGACGGGACACGAATGTCATTAGCCTCATTTTACAATCC
AGGAAGTGATGCAGTAATATATCCAGCAAAAACTTTGGTTGAAAAAGAGGCAGAGGAAAGTACACAAGTGTATCCAAAGTTTGTGTTTGA
TGATTACATGAAGTTATATGCTGGACTCAAGTTTCAAGCCAAAGAGCCAAGATTTGAAGCAATGAAGGCAATGGAAAGTGATCCAATTGC
AAGTGCTTAGATCCCAATTCAATTAAAAAAATTGGTGTTTGAAAAATATATTTAAATATAGCAATCTATGTATACCCATTATTTGCTCTT
TTTATGTATGGTAGAATAAAGTTAGTATTAAAAAAGATTGTGATTTGCTGCATATGTATCAAAAAGAGTCCTAATATTTGTATCTATAAA
TAAGGTGCCTTCTAGTGAAATTATACAAATAATAATTTGGAGTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
efe ethylene-forming enzymeethylene-forming enzyme
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (26)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)