Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U581242 and SGN-U590914 in the current build, Tomato 200607 #2
Unigene SGN-U314793

Unigene Basic Information 
Unigene ID: SGN-U314793
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 314793
mRNA sequence: Length: 1341 bp

>SGN-U314793 Tomato 200607 #1 (47 members)
GCGTGTCGCCCAAAAGATATACTCTATACTACTGCCGTCTACCGATTTCACCGCTATATATTCATTTCCTATACAATCTGTTTTCGCAGG
TTTTGTTCCAATTTCAAGGTGTTGTTGCTTCCCCAATTCACAGAGAATTGAAATTGGTGAATTTGATATGGCTGGGAAGATTATGCATGC
TGTTCAGTACGACTCTTATGGCGGTGGAGCCGCTGCCTTGAAGCATGTGGAAGTTCCTGTCCCAACTCCGAAGAAGGATGAGGTCTTGCT
AAAACTCGAGGCTGCAAGCATAAATCCTGTTGACTGGAAAATTCAGAAGGGCGTGCTTCGTCCCCTTCTTCCTACCAAGTTTCCTTTTAT
TCCTACTACCGACGTGGGAGGAGAGGTTGTAGAGGTAGGATCTAATGTAAAAAGCTTCAAGGCTGGTGACAAGGTTGTGGCTATGCTCAA
TACCCTGAATGGAGGTGGATTGGCTGAATATGCGGTGGCTAATGAGAGTTTGACTGTTCCAAGACCCGCTGAAGTATCAGCTGCAGAAGG
TGCAGGTCTTGTTATTGCAGGTCTTACAGCTCTTCAGGCCCTTGTCAATCCTGCTGAGGTTAAGCTCGATGGAACTGGACCCCGGAAGAA
CATTCTAGTTACGGCTGCTTCGGGTGGTGTCGGTCACTATGCTGTTCAACTGGCAAAACTTGGTAACACCCATGTTACTGCCACCTGTGG
AGCGCGCAATATTGATTTTGTGAAGAGCTTAGGAGCTGATGAGGTTCTTGATTACAAGACCCCAGAGGGAGCAGCTCTTAAGAGTCCGTC
AGGGCAAAAGTATGATGCAGTGATTCACTGCACGACAGGCATCCCTTGGTCTACCTTTGAGCCTAATTTAAGTTCGAGTGGAAAGGTGGT
CGATATAACTCCTGGAGTTAGTGCCATGTGGACCTTTGCAGTAAAGAAATTAACCTTCTCAAAGAAACAGTTGGTGCCACTGCTTCTGAT
TCCGAAGAAGGAAAACCTGGAATTGATTGTTGGGCTTGTGAAGGAAGGGAAACTTAAAACCGTGGTCGACTCCAGATTTCCTCTGAGCAA
GGCAGAAGATGCTTGGAGCAAGAGTATTGATGGACATGCTACCGGAAAGATTGTTGTGGAGCCATAGAGTACTGGTCTAAAAAGGCTTGT
GTGCAGTTTGTCATCTGGCTTGGAAACCAAAAAGTTAAAAGTTAAATTACAATTTACCCTTGTTATAAATTAAAATCTTATAAAAATATT
TAACTATTTAATTTGAATATTAAATTACATTATTTTAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ddtfr6a ripening regulated protein (DDTFR6/A)
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (47)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (6)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (3)