Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U580370 and SGN-U591122 in the current build, Tomato 200607 #2
Unigene SGN-U315700

Unigene Basic Information 
Unigene ID: SGN-U315700
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 315700
mRNA sequence: Length: 2059 bp

>SGN-U315700 Tomato 200607 #1 (37 members)
TTTTTTTTTTTTTTTTCTTTTCAAAAATAATCTCTCTATTTTAGATAGTTATGTTGACTTTTTTAAATTTCATATCGATTCAAAATCAGA
CAAATAAATTGACTCGTACAAAAATTTATCCACTCTTAAATTGATACATCCACCTCTACCAACCTCTATAAACACCTCACCCACCTAACA
CAACAAATAGGCAAAAAAATAAACATAGTATTATTATATTGACACCAACTTTAACAAAACCAACAAAATTCTTTGGAGGGTATTAAGCCG
TCGCTTATCTTCATCTTCTTCCTCTGATTCTGTACATTTTTCTCACCGGAAAACTCATCAGAAATGGATCCAAAGAATCAATTTTCCGAT
AACTCAGAAGCCCAAACACCTCAAGAAGAACAACAGCAGACACCCATTTTACCGATAGCTTCAATTTCACTTGCTTTATCCACAATCCTT
CCAACCCATTTCCTTAATCCTCCTAAAATCTCAACCCTTTTCAACAAACCAAACAAAGTCAAAATCCCAACTCAAGTTTCATCTCTTACA
AATCTCTCACTTTCAGCTTCTTCTCTTCCACCTACAAATTCCAAATTCAAGTCCACTATTTCTGCTAACCCTCTTCAGAATACTCTAACT
CTTAACCCTCTTCGTCCTTCTGAGCCTTCTAATGCTGCTGGGCTTCGACGAGCGTCGATTGTTTGGTTCCGTAACGATCTTCGTGTTCAT
GATAATGAGTGTCTTAACGCGGCTCATAATGAGTCCATGTCTGTATTGGCTGTTTACTGTTTTGACCCGAGAGATTATGGAAAATCCTCA
TCTGGGTTTGATAAAACTGGGCCGTATAGGGCTAGTTTTTTGATTGATTCTGTTGCTGACCTTAGGAAGAATCTACAGGCAAGAGGGTCT
GATCTTGTTGTTAGAATTGGGAAGCCGGAGACTGTGTTGGTGGAATTAGCTAAAGCTGTTGGAGCTGAAGCTGTGTATGCTCATAGGGAG
GTTTCACATGATGAGGTTAAAGGGGAAGATAAGATTGATGCTGTAATGAAGGATGAGGGTTTGGAGGTGAAGTATTTCTGGGGTAGTACA
TTGTATCATGTTGATGATTTGCCTTTTAAGTTGGAGCAAATGCCTACGAATTACGGAGGCTTTAGGGAGAAAGTGCAGGGATTGGAGGTA
AGGAAGACAATTGAGGCATTGGATCAATTGAGGGGATTGCCTGCTAGAGGTGATGTGGAACCTGGGGAGATTCCTTCGTTGGTTGATTTG
GGGCTCAATCCTAGTGCCACCATGGGTCAGAATGGAAAATCAGCTGCTAATGCTTCCCTTGTGGGAGGAGAGAATGAAGCACTGCAAAGA
CTTAGAAAATTTGCAGCAGAATGTCAGGCCCAACCCAGTAAGGAAAACAAGGATGGCACAAATGACAGCATATATGGTGCAAACTTTTCT
TGCAAAATATCGCCTTGGTTAGCTATGGGATGTCTCTCACCCCGTTCCATGTTTGATGAATTGAAGAAGTCCACTTCAAGAACGATTTCT
GCTGCCTCTGCCAAGAAAGATGGTGGTAGTGGCACTGGGCTGAACTGGCTGATGTACGAGCTGTTATGGAGGGATTTTTTCAGATTCATC
ACCAAGAAATATAGTGCTGCAAAACAAAATAGTGCTGCTCCAGTAACTACTTGCGTAGGAGCTGCTGCTTAACGATGGTATACTCAAAAG
GAGAATGAAGGTTTCCTTTTTGTAGCTTGATTTATTTTTTCCGGAAGTTTAGCTGTGGAATGTTAGAGTTGGACTGCCATTGAATTGAAG
CATTTTTTCTTTTGACAATAAGTGTTGAGACATAAAAGAATTTGTCGCCATTTCTAGCAAGTCGCTCTACAATCCTTCTTATGCTAGTAT
TTATATATTTTTGATTTCATCTGTAGTTGAAACAGGTGTGATAACAAACATACCTGTAGTTGAAATATGTGTTCCATGTTTGAGATTACC
ATCCATCTTGAACCCGCGGAGAGTATCCTTGAGCATCAGATGATTTACTATTGATACTCATTTCAATGTAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (17)  
mRNA member sequences (37)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (7)  
Annotations (manual: 2 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (1)