Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U580409 in the current build, Tomato 200607 #2

Unigene SGN-U315823

Unigene Basic Information

Unigene ID:	SGN-U315823
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	315823
mRNA sequence:	Length: 799 bp

>SGN-U315823 Tomato 200607 #1 (24 members)
ACAACTCTTCTGAGAGATATTTTTTAGTGATTAACCTTAAACAACAACAATGTCGGGAGGGATTGCTCGTGGTCGTCTTGCTGAGGAACG
CAAAGCTTGGAGAAAGAATCATCCCCATGGTTTTGTTGCTAAGCCGGAGACACTTCCAGATGGGTCAGTGAACTTGATGATTTGGCACTG
CACCATCCCTGGTAAAGCTGAGACTGATTGGGAAGGTGGTTGTTATCCACTTACAATTCACTTCAGTGAAGATTATCCGAGTAAACCGCC
AAAGTGTAAATTCCCACCAGGCTTTTTCCATCCCAATGTCTATCCATCTGGAACAGTTTGCTTGTCGATCCTCAATGAAGACAGTGGTTG
GAGACCAGCCATCACCGTGAAACAGATACTGGTTGGTATCCAGGACTTGTTAGATCAGCCAAACCCTGCTGATCCTGCCCAAACTGAAGG
GTATCATATGTTTATTCAGGATGTTCTGGAGTACCGAAAGAGGGTGCGCCTGCAGTCTAAGCAGTATCCACCTCTTGTTTAAAAGAATGT
TTGTCTAATGTTGTGGTGGCTCTATAATGTACGTCTATGTTTGCTGTCAATAGAGGACAATGAATCTGCCAGCTAGTGACTCTTATTGGT
ATTTGTTTAAGTGGAGAAGTAAATATTAATTACTACAGGATTTTATCTCTGATAGACTATATCTGTAGAAGAACAAGCACAGCTGCAAAT
TGTTATCTAAATGGTGGAAATGTGTTGAAACTTATTTTCTTTTGCAAAAGTGGAATTTCTATTCAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (16)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	LA	Leaf Mature leaves	6589	1
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	2
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOS	suspension cultures	8026	8
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	1

mRNA member sequences (24)

Alignment image suppressed for unigene with 24 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101402	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	283
2	118431	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	197
5	129694	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	17

Preceding Unigenes (1)

Unigene	Build
SGN-U214909	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer