Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U595446 in the current build, Tomato 200607 #2
Unigene SGN-U335421

Unigene Basic Information 
Unigene ID: SGN-U335421
Unigene Build: Tomato 200607 #1
Date: 2006-07-27
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: 335421
mRNA sequence: Length: 489 bp

>SGN-U335421 Tomato 200607 #1 (1 members)
CACGAGGATAGGGCTGGAACATATTTGTACCTTGCTCATTATGGTATGCAAAGACAAGCAGGACTACAAGGAATGATGAGAGTATCATTA
CCTGATGGAGTTTTAGAGCCATTTTCATATGATCATGATAGGAGTATTCTTCTCACTGATTGGTACCACAAGAGCACTTATGAACAAGCA
ACTGGTCTTGCTTCATTGCCTTTTTCTTGGGTTGGAGAACCTCAGGTAAAAAATACTATATGTACAACTTATTTCAATTCGTTTGTCTTA
TTTTGACTTAACATGGAATTTTTAATTTGTTTCTTTTTTTTCAGTCAATCTTGATTCATGGAAGAGGAAGATTCAATTGTTCTATTCCGA
CCATAGATCCTACTCTTTGTAATGCTACAAATCCTCAATGTACACCTTATTCAATGACTGTGGTTCCTGGCAAGACTTATAGGCTTAGAA
TTGGCAGCTTGACTGCTCTTTCAGCTCTAAGTTTTGAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ao ascorbate oxidaseascorbate oxidase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E209288
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (1)  
Preceding Unigenes (1)