Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U603751 in the current build, Tomato 200607 #2

Unigene SGN-U341662

Unigene Basic Information

Unigene ID:	SGN-U341662
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	341662
mRNA sequence:	Length: 402 bp

>SGN-U341662 Tomato 200607 #1 (1 members)
ATTGGTACATTTGTCAAATGGAGGGGACCTCCAGTGGAATTATTATCTAAGCTCAAGCAAGAACGTAGTTTTCTGGAGAACAATGAATCT
TCACTTGCTTTGGATGAATTAGAGATTATGTTTAAAGCTCTGGAGAAGTCCAAGTGTATTGACAGAGTGGTTTTTGACTTGAGCCTTGCA
AGAGGCCTTGATTACTACACAGGAGTCATATTTGAAGCAGTCTTCAAAGGAGCTGCTCAGGTTGGTTCGATTGCTGCTGGTGGACGTTAT
GACAACCTGATAGGGATGTTTGGGACACGGCAGGTTCCTTCTGTTGGGATCAGTCTGGGAATAGAGAGAGTATTTGCAATCTTGGAACAG
CTTCAGAAAGACAAAAATCAGGAAATTCGAGCCACTGAAACT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1

mRNA member sequences (1)

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	103096	tRNA synthetase class II (G H P and S) - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Aminoacyl-transfer RNA synthetase class II - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418)	8
2	123396	Aminoacyl-transfer RNA synthetase class II - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Anticodon-binding - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein biosynthesis (GO:0006412) tRNA synthetase class II (G H P and S) - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Histidyl-tRNA synthetase class IIa - Molecular Function: histidine-tRNA ligase activity (GO:0004821) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: histidyl-tRNA aminoacylation (GO:0006427)	4
5	133593	Aminoacyl-transfer RNA synthetase class II - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Anticodon-binding - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein biosynthesis (GO:0006412) tRNA synthetase class II (G H P and S) - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Histidyl-tRNA synthetase class IIa - Molecular Function: histidine-tRNA ligase activity (GO:0004821) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: histidyl-tRNA aminoacylation (GO:0006427)	4

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer