This unigene is from an out-of-date build, Coffea canephora #2
It has been superseded by SGN-U616848 in the current build, Coffea canephora #3
Unigene SGN-U351710

Unigene Basic Information 
Unigene ID: SGN-U351710
Unigene Build: Coffea canephora #2
Date: 2007-05-18
Organism: C.canephora
Alternative ID: 351710
mRNA sequence: Length: 906 bp

>SGN-U351710 Coffea canephora #2 (15 members)
AAGCACTACAACAAAGACTTTGGCATTGAGTGTCGTATTGGAAGGTTCCATAACATATATGGTCCATTTGGAACATGGAAAGGTGGCAGG
GAAAAGGCTCCAGCTGCTTTCTGTAGAAAAGCAATTACTTCAACAGATAAGTTTGAGATGTGGGGAGATGGACTACAAACACGTTCATTC
ACTTTCATCGATGAATGCGTTGAAGGTGTTCTTAGACTGACAAAGTCTGACTTCCGTGAGCCAGTAAATATTGGTAGTGATGAAATGGTA
AGCATGAATGAAATGGCTGAGATTGTTCTTAGCTTCGAGGACAAGAAGCTGCCCGTCCACCACATTCCTGGCCCTGAAGGTGTTCGTGGT
CGTAATTCCAATAACACTCTAATCAAGGAAAAACTTGGTTGGGCTCCGAGTATGAGACTCAAGGATGGGCTGAGAATTACATACTTTTGG
ATTAAAGAGCAAATTGAAAAGGAGAAAGGTCATGGTGTGGATTTATCAATCTATGGCACTTCTAAGGTGGTGGGAACACAGGCTCCGGTG
CAGCTTGGGTCACTTCGCGCTGCTGATGGCAAGGAGTGAAACACATTGTTTTGCTGTTTGTGCATAATAAAGTGAATCTCTTTTTCACGT
ACTAGCTACATTATAGTGGCAGAATAGAGGAATGTAGCATAATTATCTTCTCTTCAGCTGCTACTTGGGCAAATTATATGCTCCTGTGTG
TAAGGGATGCCGTTTTGCTCCTGCTTAGGTATCTAGCTATCAGTTTTCTCCTGCCTAGGTATCTAGCTCTCAGTTTGTGATGATGTAAGC
CAATATAGCAGTTTGTGCAATGCTTGTCATTTGCTCCTGCTGTTGGCATCTAATGAAGCTATCCACATTCTTCTGCAAAAAAAAAAAAAA
AAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (15)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)