Unigene SGN-U563222

Unigene Basic Information 
Unigene ID: SGN-U563222
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1606 bp

>SGN-U563222 Tomato 200607 #2 (8 members)
TAATAGTTATACATTGCAGCAGCAGAAGAAAAAATCTTTTTTGGGTATTTTCGAACGAGCTATTTTGATCCAGAAAAAAGACAATCTTTT
GGTTGAAAGGTTTGGGAAGGGATGCCTATTGAAAGGGTTGAGCAATTGGATTACATGGCAGATGACCGGGAGGGGACTGATTCATGTGAT
GAATTTGAGGGGGACTTCGATAATGAGGAGATAAACCTTGATGACGATGATATGCCAACAAAAGTGACTGATACATCAGCTGCACAAGCA
AGAAAAGGGAAGGATATACAAGGTATCACATGGGAGGGATTGAATGTAACCAGGCAAAGCTACAGATTGACGAGGCTCGAACAGTACAGA
AACTATGAGAACATCCCTTTGTCAGGAGAAGCTGTGGATAAGGTATGCGAACAAGTGGAGAAGGGTGGTAACTACTACGAATTCTTTTAC
AATGCAAGATCCGTAAAGCCTACGATACTCCATTTTCAGCTAAGAAACTTGGTCTGGGCAACTTCAAAACATGATGTGTACTTGATTTCA
AATGATTCTCTTATGCATTGGTCATCAATTTCCCGCAACCTATCAGAAGTTCTCAACTTCTCTGGACGTATAGTACCGACAGAGAAATAT
GCAGGAAATTTGTTAGAGGGTCTGACACTGACCCAAATCAGCACAATGGCGGTGAAGAACCGTTTTGTGGTTGCTGGAGGCTTCCAAGGA
GAGCTCATTTGTAAGAGTTTGGACAAGCCAGGGGTTAGCTTCTGTGCGAGGACCACTTATGAGGATAATGCTATCACAAATGCCGTTGAG
ATATATGAAAGCGTCAGTTGTGGGCCTCGTTTTATGGCAGCCAACAACGACTGTGGTGTGAGGGTGTATGACATGGAGAAGTTTCAGCAG
ATGAACCACTTCCGCTTCCCTTGGCCAGTGAATCACACCTCGGTAAGCCCAGATTGCAAGTTTTTTACTGTTGTTGGGGATGATCTAGAT
GGTTTACTTGTTGATTCCCGCAATGGAAAGACGGTGGCTTCAATCGTTGGTCATTTAGACTACTCTTTTGCTTGTGCGTGGCATCCAGAT
GGGCGTACATTTGCCACTGGGAATCAAGATAAGACATGTCGAATTTGGGACTTGAGAAACTTATCCTCGTCTACAGCCATTCTGAAGGGA
AACATCGGTGCTGCTCGATCTATCCGTTTCTCATCCGATGGACAGTTCCTTGTTGTGGCTGAACCTGCAGATTTTGTCCATATCTACAAT
ACCAAGTCAGACTACAAGAAACGTCAGGAAATTGATCTTTTTGGTGAGATATCAGGGGTATCTCTGAGCCCAGACGACGAATCTCTTTAC
ATTGGTATCTGGGATCGAACATATGGAAGCTTGCTAGAATACAACAGAAGGCATAGTTGTAGATATCTTGATTCGTTCGTGTAATCTTCA
ACCCAAGGGTTCTACAGTTCATTCACATTGAGTCCCAATATTTTGCACAAATTCGTCCCCGATTATTTTATATCAGTTCTTGATCTTGGC
ATAACTATGTACAGTTACACCTTGAGATTGAACTTTGTTTCTGGTTATATACAATCTCTCTCATGTACCATTTTGC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc09g098330 Solyc09g098330
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (8)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)