Unigene SGN-U563443

Unigene Basic Information 
Unigene ID: SGN-U563443
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 483 bp

>SGN-U563443 Tomato 200607 #2 (22 members)
GGGGACAGAAAATCAAAAGGTCAATTTTTTTCTCTCAAACTTTGTATATCACCAATTTTTTTCTCTTGAAAAACCTCACAAGCTTCTTCT
CAATTCAACCTCATCATGTCTCAGACTGTCGTTCTCAAGGTTGGCATGTCATGCGAAGGCTGTGTTGGTGCTGTGAAAAGGGTTTTGGGG
AAAATGGAAGGTGTAGAAACTTTCGACATTGATCTGAAGGAGCAAAAGGTGACTGTGAAGGGCAATGTTCAACCAGATGCTGTTCTCAAG
ACTGTGTCAAAGACTGGAAAGCCAACATCTTTCTGGGAAGCAGGCGAATCGGCTCAAACAGAAGCTGTTAGTACAGCTTGATGGTGTATA
ATGACTTGGAATTGTATGTTAAGGCTTGAGCAATATATGACTTTATCAAGAATTCTCCTATGTAATAGTTTGAAATCAGAATTGCAATAA
GTTGTTTGAGAATTTTAGTGTTGTTTTCTATGG


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
cch copper chaperone
Solyc05g055310 Solyc05g055310
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (22)  
Alignment image suppressed for unigene with 22 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 1 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)