Unigene SGN-U564868

Unigene Basic Information 
Unigene ID: SGN-U564868
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1070 bp

>SGN-U564868 Tomato 200607 #2 (26 members)
GCATACAAAATATACATATGTATATTCACTAGCATTATTGGGAAGACATGGGGAATGCGAACGCCAGAGAAGACGGCGCCGCCGGAGACG
GCGACGGCGACGGTCAGGTATCGGGAAGAAGATCTAATGTTGAATCTGGAATAGTAGAAGATCACCACGCTCTGAACTCGCGAGTGCCTT
CGGCTGACTTGATGGTCAATTCTCCTCCGCAGAGTCCACATCGTTCAGCTTCACCTCTCTTGTTCGGACCTCAGGTGCCAGTAGTTCCTT
TACAAGGAGGGGATGGCAATCCTGTTAGCAATCAAATGTGGGGCAATGAATGCGAGGATGCCTCTGATCATTCACTAGAGGGCGGCATAC
CTACTTTGATAACATGGAGTTATGGTGGTAATAACGTTGCTATCCAAGGATCTTGGGACAACTGGACATCAAGGAAAATTCTCCAAAGAT
CAGGCAAGGACTATACCGTTCTTTTGGTCCTTCCATCGGGTATATATCATTACAAATTCATTGTGGATGGGGAAGTTAGATATATTCCAG
AACTTCCATGTGTAGCAGATGAGACAGGCGTTGTCTTTAATCTTCTTGATGTTAATGACAATGTTCCAGAGAACCTCGAAAGTGTTGCAG
AGTTTGAGGCCCCACCATCACCTGACTCTAGCTATGCGCAAGCTTTGATGGGAGAGGAGGATTTTGAAAAGGAGCCAGTGGCAGTTCCAC
CGCAACTTCATCTAACTGTTCTTGGTTCTGAAAACTCAGAAGAAGCACCTTCTTCTCCAAAACCCCAGCACGTAGTACTTAATCACCTCT
TTATAGAGAAAGGATGGGCTTCTCAATCCATTGTTGCTCTTGGTTTAACGCATAGATTCCAGTCCAAATATGTCACAGTTGTTCTCTACA
AGCCACTGAAGAGGTGACCACTCCGTGTTTACAATCAAATCTTTCTAGAGCTTTCTCAGTGTGGCTGCTTTAAGATTTCCACTGTTTATA
GACCTGCTCAATGTTCAAACTTCCTTTAACCTCTCCTCTGTTGTACAATAGACCAATGCATTTTCTCGTTTCTTCCCCTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
gal83 SNF1 kinase complex anchoring protein
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (26)  
Alignment image suppressed for unigene with 26 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)