Unigene SGN-U565237

Unigene Basic Information 
Unigene ID: SGN-U565237
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1235 bp

>SGN-U565237 Tomato 200607 #2 (20 members)
ACGAAGGACAAAATTAGTAATATTTGCATCTGTAGAGGTGAAATTGTCCGTTTTGTTGTGTGGCAAATGGCAATGGCTGCCGCAAGTTGG
GCATCTTCTTCTTCGTTCACTCGCTTTCTCCGGCCTCTCCTCAGTCGGAACTCGTCTCCCTCCCCTATCAGTTACAGTCTTCATCGATAT
AAATCAGCTAACTGTTTATTTTTCTCCGCAAGCAGTAATAAACCTCCAAAATTAGCTGTTTATGCTCAAGCTAGGCGAGTTTTATCTTCC
AAAACCAAAGGAGATGAAATAGCAACTCCTGCTGACTTGAGCTTCGTGGTTCCATTGAAAATTGTGGAGTATCCAGACCCGATTTTAAGA
GCGAAGAATAAGAGGATTGACAATTTTGACGCTAATTTGAAGAAGTTAGTTGATGAAATGTTCGATATTATGTACAAAACTGATGGCATT
GGGCTGTCTGCACCACAAGTTGGAATGAATGTTCAACTAATGGTATTTAATGCAGCCGGTGAACGTGGAGAGGGGGAGGAGATTGTTCTC
GTCAATCCACGTGTCAGTAGATATTCTAGGAGGATTATACCTTATGAAGAAGGTTGCTTATCTTTTCCAATGATACATGGTGATGTTAAG
AGACCAGAGTCAGTTAAGGTTGACGCACAGGACATTAATGGTACAAGGTTTGAGATAAGCTTGTCTGCTCTTCCAGCACGAGTCTTCCAA
CATGAATTTGATCACCTACAGGGAGTTCTTTTCTTTGACAAAATGACTGACGAAGTCCTGGACACCATTCGTGAAAAATTAGTGGCGCTA
GAAAAGAAATATGAAGATAGGACTGGGTTGCCAACCCCTGAAAGCATAAATACACGAAAAATAAAGAAGGCTGCTGTTGGATTTGGCAAA
TCATGAATTTACTGGGATCTATGAAATCTTCTCAGTATTTGTATGATGAAGCACAAAATGGGATTGCCAGCTTTTGCTGAACTTTGGTAT
ATGCCATTAATTTAGACACTTGTGCTTTGTGAAACTAGCCAAAAGTGTGGCCTCTGAGGTTTATCCTTGTACTGATACTGCTCTGTTTAG
GAATGATAGGGTTACCACAGAAATTTGTATGGAAAAAGAACTGTTAAGTACATTTGATCAAATATTGAACACCAAGTTTGTCGTTTAACA
CTTGGGTTGTTGTAGTTCAGTGTGGAGAAAAACAACTCAAGAGAAGTTCCATAAGTTCCCCAGCA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AF250958 peptide deformylase AF250958peptide deformylase
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (20)  
Alignment image suppressed for unigene with 20 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 3 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)