Unigene SGN-U565381

Unigene Basic Information 
Unigene ID: SGN-U565381
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1190 bp

>SGN-U565381 Tomato 200607 #2 (3 members)
GGAACTAGCAGAGCAAAAAAAGTTTTTTTTTGTTGGCATAAGGATTTTTGTGAGCAATGGCAAAGAATTCTGCTAATGGAGATCACCAAA
CAACAACTAAGCCACCTCCAACTCCATCTCCTTTGCGCTTCTCAAAGTTTTTTCAGCCTAACATGAGAATTTTGGTTACTGGAGGAGCTG
GATTTATTGGTTCTCACCTAGTCGACAAATTGATGGAGGATGAGAAGAATGAGGTTATTGTTGTGGACAACTTTTTCACTGGTTCAAAGG
ATAATCTGAAAAGATGGATTGGTCATCCCAGATTTGAGCTTAGGCGCCACGATGTGACAGAACCCTTGTTGGTTGAAGTTGATAAGATTT
ATCATCTCGCATGCCCTGCTTCTCCAATTTTCTATAAGTACAATGCTGTTAAGACAATAAAGACTAATGTCATTGGCACGCTGAATATGT
TGGGCTTAGCAAAGCGTGTCGGAGCAAGGATTCTGCTCACGTCAACCTCAGAGGTTTATGGTGATCCTCTTGTGCATCCCCAACCTGAGA
GCTACTGGGGTAATGTTAACCCAATCGGAGTTCGAAGCTGTTATGATGAGGGGAAGCGTGTGGCAGAGACATTGATGTTTGACTACCACC
GGCAGCATGGGATTGAAATACGAATTGCTAGAATTTTCAACACTTATGGACCTCGTATGAATATTGACGATGGGCGTGTAGTCAGCAACT
TTATAGCTCAATCACTTCGGGATGAACCATTAACTGTTCAAGCTCCCGGGACACAGACTCGCAGTTTCTGTTATGTCTCTGATATGGTTG
ATGGACTTATCCGTCTAATGGAAGGGGATAACACTGGGCCAATCAACATCGGTAACCCAGGTGAATTTACCATGATTGAGCTTGCGGAAC
TAGTGAAGGAGCTTATCAGTCCGAAAGTTGAGATAAAAATGGTGGAAAATACACCAGATGATCCAAGACAAAGGAAACCAGATATCACAA
AAGCGAAAGAATTGTTAGGATGGGAACCAAAAGTGAAGTTGCGCGATGGCCTTCCGCTAATGGAAGAAGATTTCAGACTCAGGCTTGGGG
TCTCTAAGAAGATATAATAATACATCAGACAGTTTATAAACATTGATACATTTTTTGGTTTACTATATTATGTTCTTTTTGAACCAAAAT
ATGTGATATTTCTGCTATAT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 3 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)