Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U565492

Unigene Basic Information 
Unigene ID: SGN-U565492
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1444 bp

>SGN-U565492 Tomato 200607 #2 (37 members)
TTNCNGCCGGGGNNTTTTGTTATGTGTTGAAAGTCTCTCTTTCTTTCATGCTCACTCAAACTTAAGGTATATTCATCAAAGCAAAGTTCA
GACTTGACGATGGAGTCAAGCAACCCAAAGGTCATCACATGTAAAGCTGCAGTAGTATGGAAGGAGGGGGAGATGATGAAGATCGAAGAG
ATACAAGTGGATCCACCTAAATCAAATGAAGTTCGAATTAAGATGCTCTTTGCCAGTTTGTGCCACACTGATATTATCGCTTCCAATGGC
TATCCCATTCCTTTATTTCCTCGAGTTCTTGGACATGAAGGTGTTGGCATGATAGAAAGTGTAGGAGAAAATGTGACAAATCTTAAAGAA
GGAGATATTGTGATTCCACTTTACTTGGGAGAATGCAAAGAATGCCCAAATTGCAAGTCAGGGAAGTCCAATTTATGTCACAAATATCCC
TTGACCCTTTCTGGTCTAATGCTGGATGGCACAACAAGAATGTCCATTCATGGAGCACAAGTATTATACCAACTTTTTAGTTGTGCTACT
TGGTCCGAATATACAGTTATTAATGTGAACTACGTAATCAAGGTTGATCCTCAGAAGATTCCGCTTCAACATGCTAGCTTGCTTTGTTGT
GGATTTACAGCAGGTTATGGAGCAACATGGAGAGAAGTTCATGTTGAAAAGGGATCAACTGTTGCTGTACTAGGTCTTGGTGCTGTTGGA
CTTGGAGCGATTGAGGGAGCTCGAAGTCAAGGGGCATCAAAAATAATTGGTGTTGATATAAATGAATCGAAGCGGGGGAAAGGAGAAGTG
TTTGGAATGACGGACTTCATTAACCCTAAAGAATCCAAGACATCAGTTTCGGAGATGATAAAAGATGTTACTGAAGGCTTAGGTGTTGAT
TATGTTTTCGAATGTACTGGGATTCCGTCCATGCTTAATGAAGCAATTGAAGCCTCAAAATTGGGAATTGGGACAATTGTTGTAATTGGT
GCAGGACATGGACTTACTAGAGAACTCAACTTAGTTTCCTTATTATGTGGTCGAACATTGAAAGGTTCAATATATGGTGGAATAAGACTT
CACTCTGATCTTCCTGTTCTACTTCATAGATGCTCAAATAAGGAGATTCAACTAGATGAGCTTATAACTCATCAAGTTTCGTTGACTGAA
ATCAGCCAATCATTTGAGTTGTTGAAGATCCACATTGTGTCAAGATTATTATCAAGTTCTAATCACAGCTTGAAGACTTAAATATCAGAA
ATAATAATGCAGAGTTAAATTATTTACTCAATTATGAAATTGGCTTAATTTATGCACCATTTGTTGTAGGTGTATGATGAGCAAATAAAC
ATTGTATTGTTTTGTTTTGTTATAAATAAATGTGTGGCCATGTGGCTCATACACTATTGCAAAAAAAAAAAAAAAGTACTATTAGAATTG
TAGC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (9)  
mRNA member sequences (37)  
Alignment image suppressed for unigene with 37 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 1 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)