Sol Genomics Network

Unigene SGN-U565717

Unigene Basic Information

Unigene ID:	SGN-U565717
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 842 bp

>SGN-U565717 Tomato 200607 #2 (59 members)
CGGCCGGGGATCTCCATTGTCAAGCAGCACTGAAGGAGAAGAGCAACAATGGGTGCTTACACTTATGTGTCAGAGCTATGGAGAAAGAAA
CAGTCAGATGTTATGAGGTTCTTGCAAAGGGTGAGGTGCTGGGAGTACCGTCAGCTCCCATCTATTGTCCGTGTCACCAGGCCTACCCGT
CCTGACAAGGCACGCCGATTGGGTTACAAGGCCAAGCAGGGCTATGTGGTCTACCGTGTTCGTGTGAAACGTGGTGGAAGGAAGAGGCCA
GTGTCCAAGGGTATTGTGTATGGTAAACCCACCAACCAGGGAGTTACCCAACTCAAATTCCAGCGCAGCAAGCGATCTGTTGCTGAGGAG
CGTGCTGGAAGGAAATTGGGTGGTCTTAGAGTCCTCAATTCTTACTGGATTAATGAGGATTCTACCTACAAGTACTTTGAGGTAATATTG
GTTGACCAAGCCCATGCTGGTATTCGCAACGATCCAAGGATCAACTGGATCTGCAACCCAGTGCATAAGCACAGAGAACTACGTGGTCTC
ACTTCAGCTGGTAAGAAATACAGAGGACTCCGCGGAAGAGGACATCTCCACCACAAAGCTCGCCCGTCAAGAAGGGCAACCTGGAAAAGG
AACCAGACTCTATCTCTCCGCCGTTACCGTTGATCTGCTTGACCTTTTTGAGACATTATCGTTTTGCTTAATATTTTTGCATTATCTGGT
TTTTAGCCTTTTATCTCGAGACATTCAGTTGTTTACAATTTTGAACAACTATTTCATGTTGTCAGCCTTGAGAAAGTTTACTGAATTAAA
ACAATAGATTGCAGCAAATTTTGTGTTGAAAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
Solyc04g008460	Solyc04g008460

Genomic locations (0)

None

Library representation (26)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	2
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	2
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	1
Solanum lycopersicum	LB	Leaf Mature leaves	3316	2
Solanum lycopersicum	Le2TR	roots 1-,2-,3-, and 4- month-old	1179	1
Solanum lycopersicum	LeMiToLf01	leaf	30679	7
Solanum lycopersicum	Sl_RootInf02	root and collar Three weeks old	333	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	2
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	7
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	1
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	3
Solanum lycopersicum	cLER	leaf 4 weeks	5127	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	3
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	3
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	2
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	5
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	2
Solanum lycopersicum	cTSB	seed	1880	1
Solanum lycopersicum	cTSC	seed	2256	3
Solanum lycopersicum	vSlycmRNA		8362	2

mRNA member sequences (59)

Alignment image suppressed for unigene with 59 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (4)

Annotations (manual: 1 | blast: 3 | go: 4 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (1)

Unigene	Build
SGN-U312550	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: