Unigene SGN-U566122

Unigene Basic Information 
Unigene ID: SGN-U566122
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1412 bp

>SGN-U566122 Tomato 200607 #2 (154 members)
GGTATTACCTAAAACATTTTTAACAGAAATTGTTAAATATATCTAATCTAAGTAGGTATTACCGAAAAATCTTTTATACAGGGTGACATC
AAACTTTTTAAGAAACATAAACAATTGTGCCAAAATGGCATCTCATCAATTTATTTGTTTCCTAGCAATGATATCTCTTATGATTATCAA
TATTAGTGCAAACAATGCATGCCACCCTGATGATCTCAAGGGTCTCAATGACTTCAAAGCTGGCATACATTCTGATACTTCAGGCAGACT
AAGCAAATGGATTGGCCAAGATTGTTGCAATTGGCCAGGCATTTCTTGCAACTCTACAACTAATAGAGTTGTACAAATCTATTTACCTGG
TCACTATGTATCTGGTGGCGATGAATCTCCAAACTTCGTATCAAGTACAATGAGTGGTTCAATCTCCCCTTCAATTTCACTTCTCACTTC
ACTACAAGTTATTGATCTTAACAAACTAGTCGGACTAACAGGGCAAATTCCTGAGTCCATTGGGGTTCTCAAGGATCTCAAAGAACTCAA
CTTACAAACCAATCAAATCTCTAGTACAATCCCAGAGTCAGTATTCACATTGACGTCTCTAACAACCTTGAACCTTGAAAACAACCACTT
AACAGGGGAAATTTCGGAGAATATTTGCAACTTACAAGCACTTCAAAAGCTTTTCTTGTCAAACAATTCATTCACCGGAAAAATTCCACT
TTCAATCACAAAACTACATTCCATTTCCACAATCCACTTAGAAAAAAATCAACTTGTTGGTGAAATGCAATTGCCTTTAACTCCTTCCCA
ATGGCCTTCAATTAAAACTTTGGCTCTTGACAACAATGCACTTACTGGAGTTATACCTGATTCAATTGGTTATTTGACAACACTTTCATC
ACTATCTATGTCAAATAATCAACTAACAGGATCTATTCCTTCTAGTTTGGGAAACATAAAGCAATTGCAAATGTTGAAGGTCAATAACAA
CAATTTATCTGTTGAGATGTTGCCAACGACGATGTGTGGTCTTACTGAGCTAAGTGTATTGTATGTTTCTCAAAACAAGATTCATGGACC
ATTACCTGGATGCCTTTCATCATTCAAGTACTTATTAGATGTCGACGTACCATTCAAACGTACAGCCATTCTTCCTATGGGAGTACAAAA
ACAGTGACGGAGCCAGGAATTATGAAGGAAATCCAAAAATGCCTCAATTTGAAATGTTATGTATGTCTACAATAACCCAAAAAAAAAAAA
CCTTAGTGTGTTTACTTATTATCTCTATGTTATATGAGACTCCAACTAGCCAGAATCACTGGCTAGTATGAAAAAAATCTAATGCATAAA
GTACTTCCTTTGTTTTTATTTTCAAGTACTCTTTTAACTTTTATATTCTGATTAGGTATACA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
shy leucine rich repeat protein
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (154)  
Alignment image suppressed for unigene with 154 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)