Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Unigene SGN-U566573

Unigene Basic Information 
Unigene ID: SGN-U566573
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1724 bp

>SGN-U566573 Tomato 200607 #2 (7 members)
ATTCTGCACGAGCCTACATCTGCTGTTGGAGTTAATAAGAAGAAGAGTAGGAGGGTATCTAGGAATTCTTCCTTCAACAAATGCAAGGAA
GAACAGCTGCGTAAGACTCCTGGACGATTGTTCTTGAATGGATCGAGCGAGGCAGCTTCACTCTTCACTCAGCAAGGCAAGAAAGGAACG
AATCAAGATGCCATGGTTGTTTGGGAGAACTTCGCTTCCAGAACAGATACTGTATTCTGTGGTGTTTTTGATGGCCACGGGCCTCATGGC
CATATGGTTGCCAAGCGAGTCAGAGATTCCCTTCCCTCGAAGCTAAGTGCACATTGAGAAGTTAGTCTGAAAAGTGAGGATGTCCTAAAG
GAGAACAATCTAAATGCTGGGGCTAGCCTATATCCCGAGGATGCTTCCCTTATATCCGCGGCCGATGACTCTAGGGTTTCAATTGATGTT
GAACAGACTGGAAAGCACCCAGAGATCTTTCAGACTTTGAAGGAATCATTTTTGAAGGCTTATAAGGTTATGGACAGGGAACTGAAAAGC
TACACTAATATTGACTGCTTCTGTAGTGGGACAACAGCTGTAACCCTTATTAAACAGGGCCAGGATCTTGTTATAGGAAATGTAGGCGAC
TCCCGAGCAATTCTAGGTACCAGAGACAAAGATGGTTCTCTAACTGCTGTACAATTGACAGTGGATCTGAAGCCTAATCTACCAGCGGAG
GCTGAAAGAATTCGTAAATGTAGAGGGCGTGTTTTTTCTCTTCATGATGAACCAGAGGTTGCAAGAGTGTGGTTGCCAAATAGTGACTCT
CCTGGACTTGCCATGGCACGTGCTTTTGGAGATTTTTGCCTGAAGGATTTTGGTCTCATCTCTGTACCCGAAATATCATATAGGCGTTTA
ACAGGAAAAGATGAGTTCATTGTTCTGGCAACTGATGGGATATGGGATGTACTTACAAATGATGAAGTTGTAAAGATTGTTGCATCTGCT
TCATCCCGTTCGTCTGCAGCTCGATCGCTAGTTGAATCAGCTGTTCGAGCCTGGAGGACAAAATACCCTACTTCTAAAGTTGATGATTGT
GCAGTTGTTTGCCTTTTTCTTGATTCAAACTCAAACAACTTGTCCACTGCTTCCAATACAGAAGACAGTGACAAGACTGTCTCAATGAAA
GCAAATGAAGTTGGTGCCAAGACAGGTGATGCCTCAGGTCCAACTGCATTTACTCGTTCTGGAACTGTTCGAGAAGTTGAAGTTTCAGAA
GAAGAGATAGAGGAAGCATCAGAACATGAGGAACTGCTCTCAAAGGTGGGGGCGGAATGGTCTGCACTGGAAGGGGTTTCCCGGCTGAAC
ACATTATTGACACTGCCAAGGTTTGTGCCTGACAAGGACGAGAATTAAACTGTCTGGAATCGAACTCAAAGAAGCAACAGAGGGTGAGAT
TTCCAAGTTTGGATTTATTTCTTTTCGGTTATTTTTCAATTTTTATTTAGTTCCATCCATTTTAAGGTCTCACATATCTATCTACTGGGA
GGAAAAAAAAATAGGGGCATTTTATATTTGTTGTAGACTGGAAAAGTGGCCCCAGCTATATTAGAGTGTCTGGGAATCATCCATTCTCTT
CCTAGTGTTGGTAAAAGTGGAATTTTTGTAAAAACCAACTCTCCTGTCTTGGTTGCTAGCTTTCTTTTCTTTCGCATAAATACCAAGATT
GTGTGTCCCTTATC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (7)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 2 | blast: 3 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)