Unigene SGN-U568271

Unigene Basic Information 
Unigene ID: SGN-U568271
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 648 bp

>SGN-U568271 Tomato 200607 #2 (3 members)
GTGGAGATGAGCTTTTAACATGGGCTTTAGACCCCAATACTTCTTCCGGTAGTCTTCCACTTTCAACCAGAACAGTACAGGCTGTAACTG
ATATAGAAGCTTTTGCCGTCACTGCTGATGACCTCAAGTTTGTTGCTGCACAGTTTAGACGTCTAAATAGCAAGCAGATTCAGCATACTT
TCAAGTTCTGCTCACAGCAGTGGAGGACATGGGGTGCATGCTTTATACAAGTAGCATGGCGTCGATACTGCAGGAACAAGCTTGAGAAAT
CTTTACGAGTGGAAGAAGATAGACTGCAGGCTGCATTAGCAAAAGAGAGCACAAATACACCAAGTCTTGGAGCTACCATTTATGCATCAA
GGTTTGCTGCTAATGCTCTACGCGCCTTGCGACGTAAGCACGCAACTAGTGCAAAATTATCTCCCACATTACCTCTGCTGCTTCATAAGC
CATCTGAACCAGACTTCAGTGAGGAAAATGATTCATGAGGTGGGGAGGTTAATTAACTAGAAATTATGGAACTTGTCCATATTGCTTGAT
TTACATTTTCTTTATACTTTATAAAAACAACTCCTTGGGTAGTACATATGTTATATGTCTTCATTCATTATGATAATTGTAGAAATAAAA
GGGAGTTCTGTTTAACTT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc05g050380 Solyc05g050380
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)