Unigene SGN-U568369

Unigene Basic Information 
Unigene ID: SGN-U568369
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1766 bp

>SGN-U568369 Tomato 200607 #2 (22 members)
TATCAGGTTGAATCTTTTATACAAGGAATACTTACTTACATCTATGGGAGAAGCACCAGCTTTCTTTGCTGATAGTCTCTTGGGAGATTT
TCCAAATGGGATCGATTTGAAATCTAAAGGCCACAAAACAGCTATTTCTATCGGCTCTAAAATTGTATGATGATTCAACATACTGATTTG
ATATTCTACTGTGATGTGTATTCTTTCCAATTTTATATACCCAAATGACTGTATTCAATGAATGAATGTTCTGCGTCCCTATTTTCACCA
GTATGTGATTGGCGGGGCTGATCATGAGTCGACAGCGGTAATTGGAGTTCAAATATTTGAGAAATCTAGTGGGGAATGGATAAACCCCAC
TGTGCTGGGTACTAAACCCAAGGTCTCAAATGGCCACTCAGCTGTGCTTTTAAATGGTGATCGTATATTGGTTATTAAGGGCAATTCCAA
GTCTGATGAATGCTTTTGGTTTCTTGAGGTGGGCACCTCATTTATAAGAGAACAGGAAAAGACATATGGAACTGAGGTGGTTGCCTGGAG
TAAGGGAGTTTTAGGTAATGTGGAGAAGCCTATTGTCATTAGTGGCCCTTCTGGAGTGGGGAAGGGTACCTTGATATCTGAACTAATGAA
AGAGTTCCCATCTATGTTTGGATTTTCTGTGAGCCACACGACCCGGGCCCCAAGAGAAAAAGAGCAGAATGGATTTCATTACCATTTCAG
TGACCGCAGTGTAATGGAGAGAGAGATAAAGGATGGGAAATTCCTGGAGTTTGCTTCTGTTCATGGTAATCTTTATGGAACCAGTGTCGA
AGCAGTTGAGGTGGTTGCTGATGCTGGCAAGCGATGCATCCTTGATATTGATGTTCAAGGTGCAAGGTCTGTGAGAGCTAGCTCTCTTGA
AGCTATTTTCATTTTTATATCTCCACCATCATTTGAAGAACTTGAGAAGCGCCTTCGTGCAAGAGCAACTGAGACTGAAGAGCAAATCCA
AAAGCGTCTCCGAAATGCTAGGGCGGAACTCGAACAAGGAAACTCATCCGGTCTCTTTGATCATATTTTGGTGAACGATGACCTAGAAAG
TTGTTATGAGAATCTTAAGAACATCTTGGGTCTCACTGAAGGTGTGAAGACTGCTCATAAAACATATTCAGAATTAGTCGACTTGCCTGT
TGAACATTTAGTCTCGAAGATTGATCAGAAGATTTTAATTAACTGTGGTGCTGGAGAATATGAAAAGGCATCCGATAGCATGTATGTTCT
GGACTTGTCTTTGGTTAAAGGAGGGGCCCCAGGACGGACACGAGGACTAAATCTATTTGTGACCAATCCTTCGACTGATAGAGTAAATGA
CGAAAATCAGCTGAGCTAACCTACCACCTTCTGGTTTCAATAATTGTTTTTCACTTCTTACATCTCTATACGGGTAGAGAACCACAATTT
GACTACGTCATATCTTACATGGATAGTTTAGTCCCTGATGCAGCTATTAAATGAGAAATGATTTCTAATTATTAAAAAATTGTAGGTTAG
CAGCCTGAACTATTGAAAGCCTAAGATATGTAACTCTTCTACTCGAGGATTGAGCATGTTGGATGTAATTCTTTCAGCTTTTTCTATAGC
TTGCTTATTCATATCTCTTTTTTTCTTACACTGGTTGCTTCTGTTTATTTCATTGTTTCCCGTGGGGAGGTATTTTTGCTTGCTCTAAGT
GAAACATTTAAAACGTGACATGTAAAAATGAATGAAGTAAGGAATATTATTATTGG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (10)  
mRNA member sequences (22)  
Alignment image suppressed for unigene with 22 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)