Unigene SGN-U570471

Unigene Basic Information 
Unigene ID: SGN-U570471
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1569 bp

>SGN-U570471 Tomato 200607 #2 (23 members)
GGAAAATTAATGTAACCATACAAATTTCTTGAGAACAAGGATATTTCTCAGAAAGATGTTTTAACGCAACCGAACAACTGCGGCGGCACA
GCGTTGAATCCATCACGATCACCGCCACTCTAAGGCACCGATTGACCCTTTTCTTTTCCGTTGGAACATCTTAATCTCTGTCGATCTGGG
GAAAGGGATTCTCCGATTTTACAATGGATGGTAACAAAGATGAGGCTTTGAAATGCTTAAAAATCGCACAAACTTCGATTGAATCTGGAA
ATCGAGAACGGGCGTTGAAATTCTTGAATAAAGCACGTCGATTAGATCCATCGCTTGAAATTGATGATTTATTGTCACAAGCTGATGCTT
TTCAATCTAAAAGTAGTGTATCCAGCTCTCCTTCTAGCTCATCTATACCCTCTAAGTCGGGAAGTAGTTGTACTCGTCGGAGAGTTTCTT
TGTATACGGAGGAACAAGTTACAATTGTTAGGGAGATCAAGAGGAAGAAGGATTATTACGATATCTTAGGGTTGGAGAAAGGATCTAGTG
TTGAGGATGTGAGGAAATCTTATAGGAAGTTATCTTTAAAAGTTCATCCTGATAAGAACAAGGCTCCGGGGGCGGAAGAGGCGTTTAAGA
TGGTGTCTAAGGCATTTCAGTGTTTGAGTGATGCGGAGAGAAGGAGAACATATGACTCTGTTGGCTCTGAGGAGCCTGTTTATACGAGAC
ATCCTACTACACATCATCATGCTACTGGATTTCGATTTAGTGATGACGTTGATGCTGATGAGATATTTAGGAATTTCTTCTTTGGCGGTA
TGAATCCGGCAACTACTACTCATTTTAGCTTTGGCACTGGAATGGGAATGGGAGGAAATCAGGGATCAAAGTCCTTATTCAAGACTTTGA
TTCAATTGTTGCCTGTCATATTGATCTTGTTGGTCAACTTTCTACCTTCATCAGACCCAGTTTATTTATTTTCGAGGTCTTATCCATATG
ATCTTCGCCTGGCTACAGAAAGGGGTGTCAACTACTATGTCAAGTCTGGGAAATTTGAACAGGAGTATCCTGTTAATACCCCAATGCGTT
CAGCCCTTGAAGAAAAAATCGACAATGATTATTTCTCAATTCTATCTCACAACTGCAGGCTTGAGCAACAACAGCTTCATTGGGGTTATC
AACGACAAACACCAAATTGTGATACATTAAAGCAGTTCCAAGCTGCAGCTTGATTTACTATGAAAGGGTGCTGTTTCCTCCTTGTGATAT
CTTACTCCCAAAATAAATTTAGTTTTGGATTTTAGATTGACAATCATATGCAGTTTGGTCCCTTTATTTAAATCCTATATATTCATAGAT
AACTTAGTGAACTTGCCAATCTTGTTTGCATTGTTTGATAATTTCTGTGTTAAATGCAGAACATATATGTCATATTCTGTTCTGAACTCT
ACTGGATAGTAATTCATCATTCAGACCACAGGAGCTTCGATTGTTGTATTAAATTACTGCTACAATCATGATTGGAGATCCACTTCTTCT
TTTAATTGGATAAATAAATATGATTGAAGGTTGAGTTAN


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (23)  
Alignment image suppressed for unigene with 23 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 3 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)