Unigene SGN-U570991

Unigene Basic Information 
Unigene ID: SGN-U570991
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1183 bp

>SGN-U570991 Tomato 200607 #2 (24 members)
CATGGTAAAGCAGCAGTTAGTTTTCAGCACTGTACAGTACTTCGCCACGAGAGACAAAATTCTCTTTCTTCAATTCGTTTGAGTTGATAC
TACAATGTTGAATACTGAAGTAAAGCAATAAACTTTATTGAAAGGCGTTTTCGAATTTCAGGCGAAAAAATGGCTTCAATTTGTACTTCA
AATTTTCACTTTCTATGCAGAAAAAACAATCATAGCCCTATTTCTCATCATCTACTGTTATCTCCCTCTTCTTTATCCTTCTCACGTTGC
GGCGGATTGCGGTTGTGTCGTTGCGCGGCGGTGAAGACCGGTTCGGAGGGAGGAGGGATTCGGAGTGATAACGCGGAGCTGTTGCGGAAG
CCGGTGATTTCGACGGAGTTGGAGACGACGTCAGAAAGTGAGGAGTTGGTGAAGGAGGAATCGGATGATGAAGTAGGGAAGAAGAGCGGA
GATGGAGAGGGTTGGGTTGATTGGGAGGACCAGATTTTAGAGGATACTGTGCCGCTTGTTGGTTTTGTTAGAATGATTCTTCATTCTGGA
AAATATGCAATTGGCGATAGGTTAAGTCCTGATCATCAGAGAACAATTCTACAAAGATTGCTTCCATATCACCCGGAATGCGACAAGAAG
ATTGGCCCTGGAGTTGATTACATTACTGTAGGGTACCATCCAGATTTTGAAAACTCAAGATGTTTATTTATTGTCCGCAAGGATGGTGAA
ACAGTGGACTTTTCATACTGGAAATGCATAAAGGGGTTAATTAGAAAAAACTATCCACTCTATGCTGACAGTTTTATCCTCAGGCATTTT
CGGAAGCGGAGGCGTAATGACTGAATGTATCATTCGGAAACTCGTAGCTACCCTGAATTTCATGCAAAGGAGATTCTTTTACTATTGCCG
AGCACATTATGTTGAGTGTCGATCAAATATTTTTGAAGGTTGTGATATAAGTTCATATTTATTGGGAGATTACTGCAATCTACTCACAGT
AGAATTGCCCTTCCAATTACTTTGTCTAAAAATCTACACTGTAGAATTCAATTTACTCTAGTGATCAAAAGAAATTCAAGTTAGTGTAAG
TTTTGCTTAGATGGACAGGTCTCATACTATTGCAAAAGAAGCATTTTTATATTTTACCAAGTGTTGAATGATAGTATATTATGTATTAGA
GTTTTCACTTAGC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
dcl defective chloroplasts and leaves
Genomic locations (0)None
Library representation (9)  
mRNA member sequences (24)  
Alignment image suppressed for unigene with 24 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (11)  
Annotations (manual: 3 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)