Unigene SGN-U572032

Unigene Basic Information 
Unigene ID: SGN-U572032
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 744 bp

>SGN-U572032 Tomato 200607 #2 (2 members)
GTTGATGCACTATTATCATCTGATGGCAGATATAGAAGGTTTACTAGACGAGAGATTGAGGTTGCAACTGACTACTTTTCCGAGTCTAAG
ATGATTGGTGAAGGAGCATACGGGAAAGTTTACAAAGGCGATCTTGATCACACCCCTGTTGCCATCAAAGTTCTTCATTCTGATGCATCA
GAAAAGAAAGAGGAATTTCTAAAAGAGGTGGAGGTTCTTAGCCAGTTACATCACCCACACATTGTTTTACTGCTTGGAGCCTGTCCTGAA
AATGGTTGCCTTGCTTATGAGTATATGGAGAATGGAAACCTGGAAGATTACATATTGGAACGGAACAGCAAACCATTACCTTGGTTTTCT
CGATTCAGGATACTTTTTGAAGTGGCATGTGCTCTTGCATTCCTACACAACTCAAAGCCTGAGCCTGTTATTCATCGAGATCTGAAACCA
GGAAATATATTGTTGGACAAAAATTTTGTGAGCAAAATAGGAGATGTAGGTCTAGCAAAGATTATATCAGATGTTGTACCAGAAAATGTT
ACAGAATACAGGAACTCTGTTCTTGCTGGCACCCTTGGTTACATGGATCCAGAGTATCAAAGAACTGGCACACTCAGACCAAAATCTGAT
CTGTATGCTTTTGGAATAATAATACTTNCATTACTAACTGCTCGTCGTCCTAATGGCCTTATAATGAAATTTGAGAATGCTATAAATTGT
AATTCATTAGTGGATATACTTGAT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc12g008990 Solyc12g008990
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (2)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 1 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)