Unigene SGN-U574388

Unigene Basic Information 
Unigene ID: SGN-U574388
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1358 bp

>SGN-U574388 Tomato 200607 #2 (13 members)
GGCAATTCTGGCTTTGGCATACAATGCCGTACACAAACTCTGGAAGTGGCAACGGAACGAGAGGAACGTGACAGGAAAGGCATCTACTGC
TGTCCCCCCTCAATTATGGCAACCTTCCAGTGGAATTCTGATGACAAATGATATAAGCGACACAAACCCTGAAGAAGCTGTTCCATGCTT
TGCACTTTCCAAGAATGACTCTTATGTTATGTCCGCATCTGGTGGAAAAATTTCTTTGTTTAACATGATGACTTTTAAGACCATGACAAC
TTTCATGCCCCCTCCACCTGCAGCAACTTTTCTTGCTTTTCATCCACAGGATAATAACATTATTGCTATCGGAATGGAGGACTCTTCTAT
ACAAATATATAATGTTCGCGTTGATGAGGTGAAAAGCAAACTCAAAGGTCATCAGAAGAGAGTAACTGGCTTGGCTTTCTCTAGCGTTTT
GAATGTTCTGGTATCATCTGGTGCTGATGCTCAGCTATGTGTTTGGAGCATGGATGGATGGGAGAAGAAAGCCAGCAAGTTTTTGCAGAT
CCCCTCTGGTAGAGCAATAAATCCTCTTGCTCAGACACGGGTTCAGTTCCATCAAGATCAGACGCATTTGTTGGTTGTTCATGAAACACA
GATAGCAATATATGAAGCATCAAAGCTTGAATGCGTGAAGCAGTGGGTTTCACCAAATTTTGCAGTTACTGATGCGACGTATTCGTGTGA
TAGCCAATCAATTTTTGCAAGTTTTGATGATGGAAGTGTGAGTATCTTTACCGCTGCAGCACTCAAGCTGAGGTGTCGGGTGAATCCTGC
CGCCTACTTGCCTTCTAACCCAAGCTCCAGAGTATATCCACTTGTCGTTGCTGCTCATCCATCTGAATCAAACCAATGCGCAGTAGGACT
TACTGATGGCGGAGTTTATGTGCTTGAGCCTCTAGAGTCGGAAGGTAAATGGGGCACACCACCTCCAAATGAAAATGGTGTTGCCCCTGG
CATGAGCTCTGCTGCCACTGGTCTTGATCAAGCATCAAGGTAGCGGCAGTGGTCTCTCTGATGCAAATGCTCCTGTGCTATATTTTCGGG
GGAGCTGTAGATTTTCAGATCTAGGATACAACCTCTTGACGTCAGTGATAAGAAGTGGCAGTGTCTCCTGTGGAAGCTGAGACGGTATGG
AAGATCAGTTATTCAGTTAAAGGAAGGATTCAAAGAAAAAGACAAAATGTTGATAATTATAGGTAGATTAGGGATTCAGTTCAACCTCTT
GAGAAATTTTGCCTGTTTTAAGTTGTTTCTGTCCAAGCACTAAACTATGGCAGTGTAATTATCGAAAGCTCAAGCAAGCCAGTTGATTTT
ACTCTCTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc03g116750 Solyc03g116750
Genomic locations (0)None
Library representation (10)  
mRNA member sequences (13)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 1 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)