Unigene SGN-U574563

Unigene Basic Information 
Unigene ID: SGN-U574563
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 759 bp

>SGN-U574563 Tomato 200607 #2 (2 members)
TTTATAAGAGAACTAATAAAAATACAAAAACGTAAATTATTAATTTCGTCTCCAAATTATAAATAAACACCTCATGTTTTAAAAATGAAT
TTAGGAGTTTATTTCCCTTGTCAAAAAATTCAAGACTTTAATTCCCTTAATACATTTAATTAAAAGGACTATTTGATCTATTCTGAAGCC
ACCGGTGAACTAAGCAGCCGCCGTTATTAGCACATACAGATCGGAAAAACACTCCGATATGGATATAGGTCATTGCCATCTTGATGGAAA
TGCTGATGCTGTGGAGTTTTGTCCACACGAATCATTTCACAATGTTCTAGCAGCATGTACTTATACTTTACAAGAAGGAGATCAACCTAG
TAGAACTGGTAGTATATCCCTGTTTGATGTTGATGCTAATTCGAGTCGCCTTAGTTTGATACATAGAGTACAAACAGCTGGTATATTTGA
TATAAGATGGAGCCCGATCGGTGGAATTGTGGGGCCATTACTGGCTCAAGCTGATGCTGAGGGTTATGTTAGAGTTCACAAACTTGAATC
TTGTTTGGATGAATCACAAGTTCCTGGGAATAGTTTACTGGAGATAAGCGACGAACATGTCAGTTCCTCTATGTGTTTGTGTATAGACTG
GAATCCATCAGCTACATCCCTTGCTGTGGGGCTTTCAGATGGAACAGTCTCGATAATTTCATTCCTCGAGTCTCAGCTGAGCATTTCCAG
AGACTGGAAAGCGCATGACTTTGAAGTTTGGGCTGCCTC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (2)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)